5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in themRNA. 2. Write out a possible miRNA that could regulate the expression of this gene

Name: 5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in t
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in themRNA. 2. Write out a possible miRNA that could regulate the expression of this gene

Note: As per the guidelines only one question has to be answered. Please ask the other question…

Answered: 5’ UGG CAA UCC UAC GAU 3’ Write out…

Science

Biology

5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the mRNA.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 11TYK: Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What...

See similar textbooks

Similar questions

A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices 1. Asparagine 2. Lysine 3. Threonine 4. Glutamic Acid
5' UGG CAA UCC UAC GAU 3' < Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, explain how. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the mRNA. < Write out a possible miRNA that could regulate the expression of this gene
11. Draw the tRNAs on top of the following mRNA template. Make sure to include the anticodon and correct amino acid on each tRNA 5-A UGCC GUACCAGGAG-3¹
5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU 3'
Match the function with the appropriate protein or sequence: 1. Keeps two ribosome subunits apart IF3 2. Base-pairs with 3' end of 16S Shine- FRNA Dalgarno sequence 3. Prevents initiator tRNA IF2 going into the incorrect site 4. Guides the initiator tRNA IF1 to the correct site > > >
6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Tryptophan Tryp high Event Ribosome does not stall at Trp codons Region 2 of the leader pairs with region 3 Ribosome covers part of region 2 of leader Transcription is terminated before structural genes are transcribed
Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A
2b) What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?
46What is the A-site of the ribosome? A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site 47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48Pre-mRNA requires specific sequences for precise __________ to occur. A.splicingb.taggingc.replicationD.skipping