8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? A В 5' AGATGCCCТАAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' D А. А В. В С. С D. D E. None of the above
Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which…
Q: One of the following is most accurate about relative redox potential of different electron carriers.…
A: Electron carriers are molecule that is capable of accepting one or more electrons (acceptor) from…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: b. Two different liposomes have radii of 50.00 nm and 70.00 nm respectively. In a biopolymer…
A: Introduction: Liposomes are simple microscopic vesicles in which aqueous volume is enclosed entirely…
Q: In the Haworth projection for Glucose the hydroxyl on carbon 1 is shown projected up or down. b In…
A: As you have asked multiple sub part questions we are supposed to answer only first 3 subparts for…
Q: Competitive inhibitors are: Select one: O a. bind to another part b. causing the enzyme t bind to…
A: Inhibitors are molecules that bind to enzyme and block it's activity. Enzymes inhibitors are…
Q: но но- но он HN. он O Cerebroside O Sphingosine O Ganglioside O Ceramide
A: Cerebrosides are lipid complex , present in the sheaths of nerve fibers. Sphingosine forms a primary…
Q: They are related in str They have identical ba C) they are the result of a
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Give the names of the 20 Common Amino Acids and draw the structure of each.
A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…
Q: well-conserved regions in multiple sequence aligmements: a. are areas of structural importance b.…
A: Multiple Sequence Alignment (MSA) is the alignment of three or more comparable length biological…
Q: Explain how energy is invested, stored, and released via chemical reactions
A: Energy is the organism's fundamental requirement. All of an organism's actions require this energy.…
Q: THE TADLE DY REFERRING T OTHE STEP Name of Reaction Reactant Enzyme Product Phosphorylation Glucose…
A: Glycolysis is the catabolic pathway in which Glucose is broken down into 2 molecules of 3C…
Q: Describe the basic chemical requirements for the aminoglycosides. Why are these compounds strongly…
A: A base can accept the protons from the solution and can exist as a cation. An acid can donate its…
Q: 3. Based on the name of the following hypothetical drug salts, which of the following statements is…
A: The given options of hypothetical drug can be described as below in terms of acid and base:…
Q: Which of the following statements is correct about Cytochromes? Select one: O a. Cytochrome a + a3…
A: Cytochromes are redox-active proteins that contain a heme with a central Fe atom at its core.
Q: TRUE OR FALSE 1. In the structure of Aztreonam, addition of a moiety capable of Van de Waals…
A: Aztreonam is an antibiotic like penicillin and it inhibits the peptidoglycan crosslinking enzyme…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: 20. Beta-oxidation of fatty acids takes place at A. peroxisome B. mitochondria C. mitochondria and…
A: Beta oxidation of fatty acid - Process via which the fatty acids get broken down for energy…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm.…
Q: In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form gluconolactone.…
A: A glucometer is generally a little, portable device that helps to monitor (glucose levels) at home.…
Q: 4. The sequence of a peptide A formed by 16 amino acids was determined using a combination of…
A: Proteins are chain of amino acids linked by peptide bond with release of a water molecule. Alpha…
Q: A. Lysine: Polar basic: Calcium absorption B. Proline: Nonpolar imino acid: Protein synthesis C.…
A: A. Lysine is basic, has R group that is significantly positively charged at pH 7. It has second…
Q: succinate to phosphoenol-pyruvate
A: Pyruvate is transformed to phosphoenolpyruvate (PEP) via oxaloacetate (OA), which can be thought of…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme…
Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1
A: Amino acids are organic compounds having two functional group namely carboxyl and amino. Amino acids…
Q: Select the lipid that does not have any fatty acyl groups in its structure: glycerophospholipid,…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: What is another name for the glycolate pathway?
A: The process of respiration that is initiated in the chloroplast and take place only during day is…
Q: Which of the following is NOT a primary method used to regulate the activity of cyclin-dependent…
A: Cyclin-dependent kinases (CDKs) are the protein kinases which plays a role in regulating the cell…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: Which of the following enzymes is the key regulatory step in glycolysis? Phosphofructiokinase-1 is…
A: Glycolysis is a series of reactions that break down glucose into two three-carbon molecules known as…
Q: Many blood clotting proteins undergo a post-translational modification in which specific glutamic…
A: Post Translational Modifications (PTM) of such complexity is only observed in eukaryotes and not in…
Q: -Inhibitor +Inhibitor [S] (mM) V0&νβσπ; (μmol/sec). V0&νβσπ:&νβ σπ: (μmollsec) 0.0001 33 17 0.0005…
A: Km of an enzyme is the substrate concentration at half Vmax. It can be calculated from lb plot by…
Q: III. Effect of inhibitor Color of bromothymol blue indicator Test Tube Original color Final color A…
A: Bromothymol blue is a pH indicator that commonly turns yellow in acidic solution and turns blue in…
Q: When the blood glucose is low, insulin is released from the pancreas to maintain glucose…
A: Introduction: Homeostasis is the maintenance of a stable internal environment within an organism,…
Q: -Inhibitor +Inhibitor _[S] (mM) νο&νβσπ:(μmol/sec) ν0&νβσπ; &νβσπ;(μmol/sec) 0.0001 33 17 0.0005 71…
A: From the given data, I have calculated 1/S and 1/V0 in absence and presence of inhibitor. The plot…
Q: Why in infants idiopathic hypercalcemia occurs?
A: Hypercalcemia is a condition in which there occurs excess calcium in the serum of affected person.…
Q: In generating CO2, how can the citric acid cycle discriminate between the carbons in citrate given…
A: In the first phase of the citric acid cycle, acetyl CoA combines with oxaloacetate, a four-carbon…
Q: histidine has three pka values: pka=1.7 pk2=6.0, pka 9.1 a- for each pka, find the equilibrium…
A: Consider the acid dissociation reaction at equilibrium; HA⇌H+ + A- here 'HA' is the acid…
Q: ceramide with a single sugar is called? Cerebroside Plasmalogen Sphingomyelin…
A: sphingolipids : found in brain extract, contain a backbone of sphingoid bases, a set of organic…
Q: Determine the serial dilution used from the original water sample (100 mL) with 4.8 x 105 CFU as…
A: Introduction: Dilution is the process of reducing the concentration of a solute in a solution by…
Q: Which of the following contain copper atoms (Cu2*) Select one: O a. Complex II O b. Complex III…
A: There are four enzyme complexes of ETC present in the inner mitochondrial membrane. Complex 1-…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: There is an error in the lactic acid fermentation reaction given in question. The correct…
Q: What are the description of the ff? A. Enzyme influence on reaction velocity B. Effect of…
A: Enzymes are biological catalysts (also called biocatalysts) that accelerate biochemical reactions in…
Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…
A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…
Q: Match lipid descriptions in column A with the phospholipid types in column B.…
A: Phospholipids are the important class of lipids with 2 Fatty acids attached to glycerol backbone and…
Q: GLUCONEOGENESIS Reactant Coenzyme/ Product Cofactor Enzymes
A: The balance between the rate of glucose leaving and entering the blood circulation…
Q: What is the flow of genetic information?
A: The flow of genetic information is always unidirectional. It is depicted in central dogma…
Q: For the Complex III in the electron transport chain: Complex III step 1: UQH2 is oxidized in a 2…
A: In the question there are two separate processes mentioned Two electron process One Electron…
Q: 4. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen…
A: Based on their isoelectric point, protein purification can be done in an ion-exchange column (pI).…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
- 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'7. A molecule of mRNA from bacteria is shown below: 5'- GUUUCCGAGGAGGCGUAUACAUGUCAGUGGGGGC... -3' a. The ribosome binding site (RBS) is underlined. i. What molecule specifically binds to the ribosome binding site? ii. Briefly explain why this binding is necessary for initiation of translation. b. During translation, which amino acid will be attached to the first tRNA that binds in the A site of the ribosome? c. Immediately following peptide bond formation, where will the amino acid chain be located? ( ) A site of the ribosome () P site of the ribosome i() E site of the ribosome F DAS8 b U G บบบ1 UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA U GUU GUC GUA GUG PHE LEU LEU ILE AUG}MET or START VAL UCU UCC UCA UCGJ C CCU CCC CCA CCG, ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAU UAC UAG} CAU CAC S CAA CAG A AAU AAC GAU TYR STOP HIS GLN ASN AAA AAG LYS ASP GAA GAG GLU UGU UGC CGU CGC CYS UGA STOP UGG} TRP G CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG G d. Describe the events…
- 4. Peptidyl transferase activity... True False i. catalyzes peptide bond formation. ii. is an enzymatic function of proteins found in the large ribosomal subunit. iii. joins amino acids on tRNAs in the P and E site of the ribosome. iv. requires GTP hydrolysis by the elongation factor.6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
- 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA sequence responsible for the mRNA codon? c. What is the amino acid coded?1. The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? 2. Describe two features of a tRNA molecule that allow it to function as an adaptor molecule during translation.3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?