4. Nucleic acid structure - Use dashed lines to indicate H-bonds.●Draw the structure of the Watson Crick base pair that is unique to an RNA helix.Draw the structure of a G-U wobble base pair.

Nucleic acids such as DNA and RNA are polymeric macromolecules that are essential molecules of life.…

Answered: 4. Nucleic acid structure - Use dashed…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 4P: Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair...

See similar textbooks

Similar questions

34. Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure.
10.) Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent the sequence: A G T A C C G G G C A A Note: It should include items to represent - sugar molecules - phosphate molecules - 4 distinct nitrogenous base molecules (Adenine, Thymine, Cytosine, and Guanine) - two types of bonds between these molecules
5’ - A T G G C C C A A C T G A C C - 3’ a. How many nucleotides are listed here b. How many codons are listed here c. What are the three structural components of one nucleotide D.Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5’ and which end is 3 E.If the above sequence is the coding strand, write the RNA strand that will be transcribed
10.Suppose the following base sequence was found Complete the following: (10 points) nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter U A G UUU) Phe UCU UAU Tyr UGU Cys UAC J Ser UAA Stop UGA Stop UUC J UGC J UCC UCA UCG U UUA Leu UUG. UAG Stop UGG Trp G CUU CUC CUA CUG CU ССС ССА CG CAU CGU U CAC His CAA CGC Arg CGA Leu Pro Gln CAGJ CGG AUU ACU AAU AUC le A AUA ACC АCА AAC FAsn AAA AGU Ser AGC Thr AGG Arg G AGA AUG Met ACG AAGLYS GUU GUC GUA GUG GCU GCC GCA GCG GAUT GẠC, Ala GAA) GGU GGC Gly U Asp G Val GGA GAG Glu GGG First letter Third letter
1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while the sequence -Lys-Leu-Trp-Arg- may inhibit it.
8.2 nucleotide double helix Vocabulary Check base pairing rules Ma in UU 1. Label the drawing at the right with the terms nucleotide, base pairing rules, and double helix. Write each term and draw a line that connects the term to the appropriate part of the drawing. A Р P PDP D D C TCXA D. GXC P 0 100 CXG P P D ICXA P D P G D D CXG DL TCXA D D TCXA P CXG P P P AXT D P GC P D D 0 D P P P P GCD
1. For this oligonucleotide, Classify if RNA or DNA? Justify your choice. determine the sequence of this segment, labeling the 5′ and 3′ ends.
1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Considering the number of base pairs, compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3' C G A C T A C 5' 5' G C T G A T G 3'
1. Label the drawing at the right with the terms nucleotide, base pairing rules, and double helix. Write each term and draw a line that connects the term to the appropriate part of the drawing. AX P 010101010 80 Р PDP TCXA D. D C GXC P 0 CXG P P D A ICXA D P G D D CXG D TCXA DL D TCXA 0101010 D CXG P AXT D P P P P D 0 D P P P GCD LON A
1. Draw the structure of the polyribonucleotide UAGCCUG. 2. Draw the structure of the polydeoxyribonucleotide CGTAGAT.
13. a. Draw in the corresponding DNA nucleotide that would base pair with the adenine nucleotide shown below using the same level of detail as provided in the image below. Hint: Remember that DNA bases pair in the antiparallel orientation. орасна you A OH H b. How do you know the adenine nucleotide drawn above is from DNA and not RNA?
5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'-GGCAACGGTCCAGTCCAAGTTACG-3' 6. What are the amino acids coded for by this sequence of nucleotides: ATG GGA ACT CCA 7. What is the complementary messenger-RNA sequence for the DNA sequence shown below? ATC GGA CCG ATT GCC

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

4. Nucleic acid structure - Use dashed lines to indicate H-bonds. ● ● Draw the structure of the Watson Crick base pair that is unique to an RNA helix. Draw the structure of a G-U wobble base pair.