Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure

Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 16QP: A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA...

See similar textbooks

Similar questions

Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
List the pyrimidine bases, the purine bases, and the base-pairing rules for DNA.
N. NH 2. One of the key pieces of information that Watson and Crick used in determining the secondary structure of DNA came from experiments done by E. Chargaff, in which he studied the nucleotide composition of DNA from many different species. O=P-OCH, N. `NH, HN он O= P- OCH, NH, Chargaff noted that the molar quantity of A_was always approximately equal to the molar quantity of T. and the molar quantity of C was always approximately equal to the molar quantity of G. How were Chargaff's results explained by the structural model of DNA proposed by Watson and Crick? N OH N. O= P-OCH, OH OH
5’ - A T G G C C C A A C T G A C C - 3’ a. How many nucleotides are listed here b. How many codons are listed here c. What are the three structural components of one nucleotide D.Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5’ and which end is 3 E.If the above sequence is the coding strand, write the RNA strand that will be transcribed
Draw the complete structure of the trinucleotide deoxyribo-oligonucleotide that is complementary to 5'dTdGdA3'. Draw this completely, showing all atoms of all parts of the structure.
If this nucleotide were found in a DNA polymer, the (X) group would be group would be A NH ₂ -0-CH₂, +] -0 B (X) (Y) and the (Y)
1.Draw these phosphorylated structures as they would be connected in a polinucleotide (e.g.RNA) in the order A-B. / Show how they combine to form the polynuleotide (i.e. only the end product). Show at any one of these structures where the glycosidic bond occurs 2.Sanger sequencing revealed the sequence of an oligonucleotide to be: d-AGATGCCTGACT. Draw a diagram of the gel banding pattern post capillary electrophoresis i.e. where on the gel would the fragments feature
Identify the correct name or abbreviation for the given nucleoside or nucleotide. guanosine ADP dADP dGDP GDP Identify the correct name or abbreviation for the given nucleoside or nucleotide. GDP dADP ADP O deoxyadenosine dGDP OMP O || -O-P-O-P-O. fot O™ tt -O-P-O- O™ ܘ ܐ ܘ ܐ OIPIO N OH OH OH N H₂N N ΝΗ N NH₂
10.Suppose the following base sequence was found Complete the following: (10 points) nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter U A G UUU) Phe UCU UAU Tyr UGU Cys UAC J Ser UAA Stop UGA Stop UUC J UGC J UCC UCA UCG U UUA Leu UUG. UAG Stop UGG Trp G CUU CUC CUA CUG CU ССС ССА CG CAU CGU U CAC His CAA CGC Arg CGA Leu Pro Gln CAGJ CGG AUU ACU AAU AUC le A AUA ACC АCА AAC FAsn AAA AGU Ser AGC Thr AGG Arg G AGA AUG Met ACG AAGLYS GUU GUC GUA GUG GCU GCC GCA GCG GAUT GẠC, Ala GAA) GGU GGC Gly U Asp G Val GGA GAG Glu GGG First letter Third letter
(a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue while the protein residues are in black (M1 and M2 are metal ions, they are irrelevant to this question). 3' Base reaction. M² 5' 00 3' Glu 357 M¹ Draw the structure of the final DNA product for this reaction. Draw a square around the nucleophile and draw a circle around the leaving group in this Does this depict the reaction of an endonuclease or an exonuclease?
There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
draw a strand of DNA 4 nucleotides long (4 nucleotides on each side). Label the 5’ ends, the 3’ ends, the bond that holds the DNA backbone together, the glycosyl bond, and the bond that holds the nitrogenous bases together. You can use “P” to represent phosphate, and ATCG to represent the nitrogenous bases. Please try to draw the sugar accurately and include any unbonded functional groups, including the oxygen within the molecule.