Concept explainers
Cloning can be done by somatic cell nuclear transfer (SCNT) (see Figure 20-12). Some conservation biologists have proposed using SCNT technology to preserve highly endangered animal species. What might be some of the genetic disadvantages of this approach?
Figure 20-12 Dolly, the First Mammal Cloned from an Adult Cell. (a) Dolly was cloned from a serum-starved mammary (udder) cell that was fused with an egg cell from which the nucleus had been removed. (b) Dolly as an adult.
To explain: The genetic disadvantages of cloning done by Somatic Cell Nuclear Transfer (SCNT).
Introduction: In sexual reproduction, genetic information from both the parents is combined together to produce the offspring. A cell having two sets of chromosomes is known as diploid whereas, a cell having a single copy of chromosomes is known as haploid. Sperms are the gametes produced by males and eggs are the gamete produces by females, these gametes fuse together to form a zygote.
Explanation of Solution
An offspring which is the identical copy of the parent is known as its clone. Asexual reproduction is a method to produce clones naturally. Clones can also be produced artificially in the laboratories. Somatic cell nuclear transfer is a method of producing clones artificially. In the somatic cell, nuclear transfer nucleus from a somatic cell is implanted into an enucleated oocyte to produce an embryo. Therefore, SCNT can be used for cloning experiments. Dolly the sheep was the first clone produced by the technique.
Following are the genetic disadvantages of cloning done by SCNT to preserve highly endangered animals:
- As the clones are identically similar to the parents, genetic diversity will decrease in producing a clone through SCNT and as a resulting susceptibility to a particular genetic disease carried by the parent will increase in the next generation.
- Producing clones will also increase homozygosity and decrease the chances of evolution.
- Incomplete reprogramming of the cells can also produce abnormal phenotypes.
Thus, SCNT has certain genetic disadvantages such as production of abnormal phenotypes, an increase in homozygosity, an increase in susceptibility to genetic diseases.
Want to see more full solutions like this?
Chapter 25 Solutions
Becker's World of the Cell (9th Edition)
- The following diagram outlines how the process of cloning a sheep was accomplished. Cloning is the process of creating a genetically identical copy of another individual. With Dolly, the first cloned mammal, an egg cell was removed from a donor (B) and the nucleus was removed from the egg cell. Then cells from a sheep's mammary gland were removed from a second donor (A). The nucleus of one of the cells from the mammary gland was fused with the enucleated egg cell using an electrical pulse. The fused cell underwent cell division and at the blastocyst stage was implanted into a surrogate mother sheep. The percentage of genetic material that Dolly (the clone) had in common with Donor A is Select one: a. 25% b. 50% c. 100% d. 0%arrow_forwardUnneeded genes in an adult animal cell are permanently inactivated,making it impossible for most specialized cells to turn into any othercell type. How does this arrangement save energy inside a cell? Whydoes the ability to clone an adult mammal depend on techniques forreactivating these “dormant” genes?arrow_forwardFor each of the following scenarios, indicate YES (it is cloning) or NO (it is not cloning). 6. ___________ Sperm taken from a male goat is combined with a female's egg in a petri dish. The resulting embryo is implanted into the female's uterus to develop 7. ___________ A sheep embryo, composed of 16 cells, is removed from the mother's uterus and separated into individual cells. Each cell is allowed to multiply, creating 16 separate embryos, which are then implanted in different female sheep to develop to maturity. 8. ___________ A cow with many desirable traits is stimulated with hormones to produce a number of egg cells. Each of these eggs is fertilized and implanted into a surrogate mother. 9. ___________ Cell nuclei from a recently deceased dog are placed into enucleated egg cells from another female dog. These egg cells are then placed into the uterus of an additional female surrogate dog, where it grows into a puppy.arrow_forward
- Northern blotting, RT-PCR, and microarrays can be used to analyze gene expression. A lab studies yeast cells, comparing their growth in two different sugars, glucose and galactose. One student is comparing expression of the gene HMG2 under these two conditions. Which technique(s) could he use and why? Another student wants to compare expression of all the genes on chromosome 4, of which there are approximately 800. What technique(s) could she use and why?arrow_forwardWooly Mammoths have been extinct for about 10,000 years; however, their remains have been well persevered in Siberia. Due to global warming, these remains are now available to be recovered. Scientists want to extract the DNA and through cloning insert the DNA into an elephant to clone the mammoth. What are some of the pros and cons of cloning an extinct animal?arrow_forwardIn recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed . Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an eggcell, only a small percentage of the resulting embryos complete development, and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred to an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science 293:1095–1098). Propose a possible reason for why a higher percentage of cloned embryos develop successfully when the nucleus transferred comes from an undifferentiated embryonic stem cell.arrow_forward
- Do all of them True/False 31) The process by which an electrical charge is used to introduce DNA into a cell to produce a transgenic organism is called electroporation.Answer: 32) Reproductive cloning is used to produce large amounts of mammalian proteins from transgenic agricultural animals such as cattle.Answer: 33) In gene addition, homologous recombination is used to remove the original gene and replace it with the cloned gene.Answer: 34) All stem cells have the potential to differentiateAnswer: 35) A bone marrow transplant involves the transfer of multipotent stem cellsAnswer: 36) The fact that in mammalian systems multiple genes may compensate for the loss of a gene is called gene redundancy.Answer:arrow_forwardAll the cells of one organism share the same genome. However, during development, some cells develop into skin cells while others develop into muscle cells. Briefly explain how the same genetic instructions can result in two different cell types in the same organism.arrow_forwardThe technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…arrow_forward
- By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardDo a few cells created by therapeutic cloning of your own somatic cells constitute life? If these cells do constitute life, do they have the same rights as a human being conceived naturally? If it were possible, should someone be allowed to grow his or her own therapeutic clone into an adult?arrow_forwardYou just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteomearrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning