Concept explainers
(a)
To determine: The reason that a recA protein mutation in Escherichia coli make it a better host for the propagation of recombinant plasmid DNA (Deoxyribose
Introduction: Restriction endonucleases which are also called molecular scissors are the enzymes that are used in molecular biology for the formation of the recombinant molecule. Plasmid vectors act as the carriers of foreign information that has to be incorporated into a recombinant molecule.
(b)
To determine: The reason that mutations in restriction endonucleases of Escherichia coli are useful.
Introduction: Restriction endonucleases which are also called molecular scissors are the enzymes that are used in molecular biology for the formation of the recombinant molecule. Plasmid vectors act as the carriers of foreign information that has to be incorporated into a recombinant molecule.
Want to see the full answer?
Check out a sample textbook solutionChapter 25 Solutions
Becker's World of the Cell (9th Edition)
- gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardRestriction mapping of a plasmid: Digestion of a plasmid pCHEM1234 with the following restriction enzymes (single and double-cut) resulted in the fragments below. Draw a restriction map of the plasmid using the data provided below A. PCHEM 1234. Shown below are the restriction fragments BamHI 52 kb Hind III 26, 12, 8, 6 kb BamHI and HindIII double digest 14, 12, 8, 6 kbarrow_forwardYou have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.arrow_forward
- The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the restriction enzyme sites at the ends of the human DNA insert. Hint: think about the compatibility of the ends generated by partial digestion of human DNA and complete digestion of the vector – will the original sites in the vector be regenerated or not, or it is impossible to predict?arrow_forwardIn the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardTrue or false? DNA repair mechanisms all depend on the existence of two copies of the genetic information, one in each of the homologous chromosomes. DNA primase makes DNA primers for the synthesis of Okazaki fragments in the DNA lagging strand. The repair of double-stranded breaks by nonhomologous end joining is accurate. RNA polymerase III transcribes all protein-coding genes.arrow_forward
- Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardClone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*arrow_forwardB. Restriction Mapping. Single and double digestion of plasmid pMCS326 were performed using the restriction enzymes Alulll and EcoRV. DNA fragments are shown in an electrophoretogram below. Construct a restriction map of plasmid pMCS326 for enzymes Alulll and EcoRV. 20 kb 11 kb 8 kb 6 kb kb 3 Alulll + Alull EcoRV ECORV | || Restriction Map:arrow_forward
- You first need to create a plasmid. What are the minimal components necessary to develop this plasmid? In addition to these components, please draw the plasmid. In this illustration, I am looking for the components, the direction of transcription (i.e., the direction the genes will be transcribed), and what should be transcribed last? Also, where would you specifically insert the P. falciparum gene in this plasmid, and why are you checking reading frames in your gene? Finally, please name your plasmid using the correct nomenclature too. You are excited you have this new plasmid; you want to transfect it into P. marinus and provide it as an oral vaccine to laboratory mice. However, even though your supervisor enjoys your enthusiastic attitude, they do not allow you to do this quite yet because all you have is this plasmid. Why doesn’t your supervisor allow you to use the laboratory mouse for this research regarding animal welfare guidelines? Your answer should include the 3 R’s of…arrow_forwardTRUE OR FALSE. a) The Sanger method of DNA sequencing follows the principle of complementarity just like in the replication process. b) Supercoiling whether positive or negative, can be experienced in the replication or transcription process.arrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning