Question 22 STRs are useful for DNA profiling because they O are easily connected to human phenotype O are highly variable in human populations O code for proteins O are strongly influenced by selection Question 23 What is predictive DNA Phenotyping?
Q: List all the antibiotics in the above table that work through destroying the bacterial cell wall.…
A: In addition to the four described above, glycopeptide antibiotics target the bacterial cell wall.…
Q: Which statement is NOT true about the early hominins: A) The angle of the foramen magnum on…
A: The objective of the question is to identify the statement that is not true about the early…
Q: Immanuel Kant’s Investigation of the Question Whether the Earth Has Undergone Any Change in Its…
A: The objective of the question is to understand the theory proposed by Immanuel Kant in his work…
Q: (1 point) Humans with the genotypes DD and Dd show the Rh+ blood phenotype, whereas those with the…
A: 1. To determine the allele frequency of the allele D in the population, we can use the…
Q: ory X Gakg614 micro x Mail - Kayli Je X Google Docs × <for X Xavier Univer x…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: pls make sure it’s correct and asap
A: The body maintains homeostasis through three main types of regulatory systems:Negative Feedback…
Q: I’m not sure about this one
A: In the prevention of bacterial growth inside stored or canned food, salt and sugar function by…
Q: Marasmus is associated with ____. a. changes in skin and hair pigmentation b.…
A: The question is asking to identify the symptom that is associated with Marasmus, a severe form of…
Q: ons: On They will select and present a label for a pet food. They will identify on the label each of…
A: 1. **Main Display Panel** - This is typically the front of the package and includes the brand and…
Q: What is gymnospermatophyta?
A: Solution:Gymnospermatophyta are a group of seed-producing plants that includes conifers, cycads,…
Q: Description of Activity Prevents the repair or synthesis of phospholipids Breaks open bonds between…
A: let's delve into each aspect in more detail: 1. Cidal or Static: - **Cidal Agents:** These agents…
Q: Match the following terms with the best description. Question 6 options: A…
A: The objective of the question is to match the given terms with their correct descriptions.
Q: just answer the questions nothing to conpl
A: Approach to solving the question: Offspring-List the phenotypes (both color & number) The…
Q: How does light pollution negatively impact sea turtles? Explain
A: Overall, light pollution poses a significant threat to sea turtles by disrupting their nesting…
Q: The adaptation planning process starts with a stakeholder meeting. Which one is NOT a purpose of…
A: The question is asking to identify the option that is not a purpose of the initial stakeholder…
Q: Answer the following questions about insulin: 1. What is the difference between general…
A: Question 1General transcription factors and specific transcription factors, also known as genetic…
Q: Question 17 How do we go from a genetic association to a causal relation between a gene and a…
A: The correct answer is (d) By silencing a gene, we can study the effect of that gene on the…
Q: Question 13 Which of the following is TRUE about whole-genome shotgun sequencing? O The first…
A: The first published human genome used the whole-genome shotgun sequencing technique. TRUE - Craig…
Q: Number of individuals 10 8 6 4 64 2 0 6 On balloon vine fruits Beak- Museum-specimen average On…
A: Detailed explanation: Natural selection decreases beak length in soapberry bug populations: This…
Q: Homo floresiensis describe the fossil/ DNA etc. and where it comes from. Describe what makes this…
A: Homo floresiensis, often referred to as the 'Hobbit', is a species of small archaic human that…
Q: Describe the action potential conduction and neurotransmission process from one neuron to another,…
A: Chemical Transmission (Neurotransmission):The connections between neurons, or synapses, are where…
Q: Fill in the blank with the appropriate volume range for the micropipette size. Size P20 Volume μι -…
A: The limits are: P10: 1.0 - 10.0 !l P20: 2.0 - 20.0 !l P200: 20 - 200 !l P1000: 200 - 1000 !l
Q: Describe the progression of cancer from an early benign lesion to a genetically heterogeneous…
A: Cancer, characterized by uncontrolled cell growth and spread, progresses from benign lesions to…
Q: Identify the three individuals whose investigations led to the banning of the use of…
A: I have provided the answer above for you. See the answer I provided above to understand the given…
Q: Discuss the concept of myelination and the purpose of the myelin sheath
A: 1.Imagine your nervous system as a network of wires that are responsible for conveying electrical…
Q: You have recently joined the QC team in a milk factory. Your supervisor told you they have routine…
A: When it comes to assuring the safety and uniformity of the product, having two separate methods for…
Q: Imagine the unlikely case that the 11 individuals represented in the gel image above were truly…
A: Approach to solving the question: Detailed explanation:According to the numbering system given, the…
Q: Do you think that OSHA serves a valued objective today? Or should industry manage its own affairs…
A: In today's business environment, OSHA, or the Occupational Safety and Health Administration,…
Q: STEM Workplace Practices
A: The concept of Design of Experiment (DOE) and how it can be applied in process development.Objective…
Q: Describe some of the key characteristics of Homo habilis - the first species in our genus "homo".…
A: I hope these suggestions and recommendations help you with your assigned tasks. To further…
Q: 26-27) List all the antibiotics in the above table that work through inhibiting replication (if…
A: Self explanatoryHope the answer was helpful. If any doubts feel free to ask for further…
Q: Evaluating the positive and negative effects stress has on the human body 1. Does stress affect our…
A: Approach to solving the question: In exploring the question of whether stress affects our ability to…
Q: The new classification of the 3 Domains of life is based on: a) comparisons of the ribosome b)…
A: The objective of the question is to identify the basis for the new classification of the three…
Q: Question 19 Which of the following is FALSE in relation to CRISPR/Cas9? O Cas9 needs a PAM site…
A: Cas9 needs a PAM site consisting of an NGG sequence. True - The Cas9 enzyme requires a short…
Q: Briefly discuss the effects of screen use in children
A: Approach to solving the question: To address the effects of screen use in children comprehensively,…
Q: 1. The Petri Dish method is used in microbiology to raise bacteria in: a) rapid growth b) pure…
A: Key references: Books
Q: Compare and contrast the Oldowan and Acheulean tool industries. Provide a personal reflection on…
A: I hope these suggestions and recommendations help you with your assigned tasks. Have a great day…
Q: Genetics Q7
A: Based on the information that has been provided, it is not possible to tell which children are the…
Q: Experiment The effect of starvation on protein synthesis in Caenorhabditis elegans was studied in…
A: 1. At the top of the gradient the molecules that are detected by UV absorption are small RNA…
Q: Micropipettes have a two-position plunger with friction stops. Depressing to the (first / second)…
A: Hold the micropipette almost vertical when filling it. Notice the friction "stops" on the…
Q: make sure it’s correct i need asap pls
A: Psychological dependence can disrupt the body's homeostatic processes and lead to significant…
Q: What are the subsectors of the fisheries and aquaculture sector? Select two or more:…
A: The question is asking to identify the subsectors of the fisheries and aquaculture sector. The…
Q: Which one of the following measures CANNOT mitigate emissions of greenhouse gases in aquaculture?…
A: The objective of the question is to identify which of the given options cannot help in reducing the…
Q: QUESTION 6 A series of experiments were performed in Neurospora crassa in order to define the…
A: 1. Precursor and Intermediates:The precursor molecule is the starting point of the biosynthesis…
Q: Q11. One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is…
A: CACNA1S is a gene that encodes the alpha subunit of the L-type voltage-dependent calcium channel,…
Q: Lucy, a 30 year old opioid addict is taken to hospital and is believed to be suffering from MPTP…
A: MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) poisoning is a serious illness that can result…
Q: Humans share almost 99% of our DNA with chimpanzees and bonobos. True or false?
A: The objective of the question is to verify the statement that humans share almost 99% of our DNA…
Q: A child with Type O blood is born to a mother with Type B blood. What is the genotype of the child?…
A: The child has type O blood because they inherit two "O" genes, one from each parent. The mother has…
Q: Discuss how adaptations allowed plants to move from an aquatic environment to the variety of…
A: Key references:1. Evert, R. F., Raven, P. H., & Eichhorn, S. E. (2012). Raven biology of plants.…
Q: Neanderthals used projectile weapons. True or false
A: The question is asking whether Neanderthals, an extinct species of archaic humans who lived in…
Step by step
Solved in 2 steps
- Fig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 2+ Jimenez me O Lab Interac O (71) Alfie Ca G lab concord G quantum m b Success Cor a holodeck * Regression * Page missir G regression O Lab Inte x Ask Your ST + Lab Interac A Not secure | http://lab.concord.org/embeddable.html#interactives/sam/DNA-to-proteins/4-mutations.json Share About DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG Edited sequence Apply Show DNA Transcribe Translate Show protein Continue one step Start/continue model Stop Reset The Concord Consortium 9:45 pm 12/05/2022 30°C ENG 4) O Partly cloudy US (7.Variations in Phenotype Expression A genetic disorder characterized by falling asleep in genetics lectures is known to be 20% penetrant. All 90 students in a genetics class are homozygous for this gene. Theoretically, how many of the 90 students will fall asleep during the next lecture?
- Question 17 How do we go from a genetic association to a causal relation between a gene and a phenotype? ◇ We can use a GWAS with many different samples to identify causal alleles. O We can quantify gene expression of a gene of interest and determine the relationship with a phenotype. O We can determine how often an associated allele occurs in cases that have a disease, which will allow us to determine a causal relationship. By silencing a gene, we can study the effect of that gene on the phenotype. Question 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune response against viral infection a molecule involved in regulation of expression66 Comparisons of DNA sequences among humans have revealed many types of variations. Which of the following variations involves duplication of relatively long stretches of DNA? Select one alternative: O Copy number variants O Single nucleotide polymorphisms O Short tandem repeats O DNA ligationQUESTION 8 Which statement about SNPS in the human genome is true? O Most SNPS are located in the introns of genes, and thus effect phenotype. Any two human genome copies will have on average 3 million single nucleotide polymorphisms. Most SNPS have an effect on phenotype. SNPS refer only to deletions or insertions, not base substitutions.
- Question 7 What is the function of primase? It O synthesizes an RNA primer. O separates DNA strands. synthesizes the DNA O joints Okazaki fragments. O removes primer.Question Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Leu O The normal amino acid sequence of a protein is Met-Ala-Phe Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Tyr O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-STOP Moire to the net question prevents changes to this angNHelp me please
- 7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in situ hybridization (FISH) O subset of STS markers are known as expressed sequence tag (EST) markers O can readily be screened by a PCR assay O short DNA sequences that occur at a unique location in the genome| Choose ) [ Choose] metagenomics whole-genome shotgun approach bioinformatics ed GenBank genomicsG where can Question 29 Not yet answered Points out of1.00 P Flag question When a gene is re-ordered on a chromosome, this is called example of this is the evolution of humans from chimpanzees. About 4,04 An https://www ribosom Palade, who Select one: eukaryotic c O a. Inversion People O b. Insertion Where can O c. Duplication Where are O d. Deletion Can riboso Where can Time left 0:55:56 Next pa DELL