Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 27QP
Variations in
A genetic disorder characterized by falling asleep in genetics lectures is known to be 20% penetrant. All 90 students in a genetics class are homozygous for this gene. Theoretically, how many of the 90 students will fall asleep during the next lecture?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Normal
wife
Affected
husband
As a genetic counsellor you are presented with a married
couple where one of them has a family history of this
disease. The husband is affected by this disease and the
wife is normal. The couple, who are thinking of starting a
family, would like to know what their chances are of having
a child born with this condition. They would also like to
know what the probabilities are of having an affected boy
or affected girl. Use the symbols above to complete the
diagram right and determine the probabilities stated below
(expressed as a proportion or percentage).
Parents
4. Determine the probability of having:
Gametes
(a) Affected children:
Possible
(b) An affected girl:
fertilizations
(c) An affected boy:
O O O O
Children
Affected aite
if
耳
**GENETICS**
why does the map distance calculated between 2 genes need to be adjusted using a
mapping function if the calculated frequency is greater than .07 or 7 map units?
(7) In a family-based alcohol use disorder genetic study, a total of 50 families, each with a pair of
siblings, were recruited. The result showed that 12 families have the 1" siblings with marijuana
dependence and the 2nd siblings without the disorder, while another 11 families are opposite (i.e. the 1st
siblings without the disorder but the 2nd siblings with the disorder). In contrast, 20 families have both
siblings exhibiting the disorder and another 17 families have both siblings without the disorder. What
kind of heritability can you calculate using this family study and what is the heritability value for
alcohol use disorder?
A) Narrow-sense heritability, approximately 88%
B) Narrow-sense heritability, approximately 44%
C) Broad-sense heritability, approximately 88%
D) Broad-sense heritability, approximately 44%
Chapter 4 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 4.3 - Does a pedigree drawn from the available...Ch. 4.3 - Prob. 2EGCh. 4.7 - Did the fact that Prince Albert and Queen Victoria...Ch. 4.7 - Which members of the pedigree could have been...Ch. 4 - Pedigree analysis is a fundamental tool for...Ch. 4 - Pedigree analysis is a fundamental tool for...Ch. 4 - Pedigree analysis is a fundamental tool for...Ch. 4 - Pedigree Analysis Is a Basic Method in Human...Ch. 4 - Pedigree Analysis Is a Basic Method in Human...Ch. 4 - Pedigree Analysis Is a Basic Method in Human...
Ch. 4 - Pedigree Analysis Is a Basic Method in Human...Ch. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - Use the following information to respond to the...Ch. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - A proband female with an unidentified disease...Ch. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - Prob. 12QPCh. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - Analysis of X-Linked Dominant and Recessive Traits...Ch. 4 - Prob. 16QPCh. 4 - Analysis of X-Linked Dominant and Recessive Traits...Ch. 4 - Analysis of Autosomal Recessive and Dominant...Ch. 4 - Analysis of X-Linked Dominant and Recessive Traits...Ch. 4 - Analysis of X-Linked Dominant and Recessive Traits...Ch. 4 - Analysis of X-Linked Dominant and Recessive Traits...Ch. 4 - Analysis of X-Linked Dominant and Recessive Traits...Ch. 4 - Prob. 23QPCh. 4 - Prob. 24QPCh. 4 - Variations in Phenotype Expression Define...Ch. 4 - Prob. 26QPCh. 4 - Variations in Phenotype Expression A genetic...Ch. 4 - Variations in Phenotype Expression Explain how...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Genetics in Practice case studies are critical-thinking exercises that allow you to apply your new knowledge of human genetics to real-life problems. Case study Michelle was a 42-year-old woman who had declined counselling and amniocentesis at 16 weeks of pregnancy but was referred for genetic counseling after an abnormal ultrasound at 20 weeks of gestation. After the ultrasound, a number of findings suggested a possible chromosome abnormality in the fetus. The ultrasound showed swelling under the skin at the back of the fetuss neck; shortness of the femur, humerus, and ear length; and underdevelopment of the middle section of the fifth finger. Michelles physician performed an amniocentesis and referred her to the genetics program. Michelle and her husband did not want genetic counseling before receiving the results of the cytogenetic analysis. This was Michelles third pregnancy; she and her husband, Mike, had a 6-year-old daughter and a 3-year-old son. At their next session, the counselor informed the couple that the results revealed trisomy 21, explored their understanding of Down syndrome, and elicited their experiences with people with disabilities. She also reviewed the clinical concerns revealed by the ultrasound and associated anomalies (mild to severe intellectual disability, cardiac defects, and kidney problems). The options available to the couple were outlined. They were provided with a booklet written for parents making choices after the prenatal diagnosis of Down syndrome. After a week of careful deliberation with their family, friends, and clergy, they elected to terminate the pregnancy. Do you think that this couple had the right to terminate the pregnancy in light of the prenatal diagnosis? If not, under what circumstance would a couple have this right? What other options were available to the couple?arrow_forwardWhich of the following terms means many genes? polymorphism polygeny polypeptide multiple allelesarrow_forwardFilm name: In the womb: Multiples Question: 1. Explain what epigenetic theory is. 2. From the film, In the Womb: Multiples, select an example where epigenetic theory is at work. Tell what this example is and explain how it is an example of the epigenetic theory. The example must come from the film. Flim main theme & Link: 1. "In the Womb: Multiples" National Geographic Video Summary ( https://studycorgi.com/in-the-womb-multiples-national-geographic-video/#:~:text=The%20video%20shows%20the%20natural,they%20had%20a%20small%20weight. ) 2. National Geographic In The Womb Multiples ( https://www.youtube.com/watch?v=BoMQrVBxa_w ) N.B: Please expert follows those links that I give you.arrow_forward
- stion 20 of 20 CO Epigenetics is the study of heritable traits that are not induced by changes to DNA sequence. Epigenetic changes can be inherited during somatic cell division to regulate the daughter cells of an individual organism. Most epigenetic modifications are reset prior to meiosis. However, some epigenetic changes can be inherited across generations. For example, environmental factors such as nutrition and chemical exposure can induce heritable epigenetic changes in animal models (Relton and Davey Smith, 2012). Genome imprinting is one type of epigenetic modification in which a cell or organism can reduce the expression of a gene and thereby silence the gene. Genome imprinting is caused by DNA methylation and histone modification, which reduce expression of a gene. The silencing occurs in a parent-of-origin-specific manner, where either the maternally derived allele or the paternally derived allele is imprinted and silenced. Expression occurs only through the nonimprinted…arrow_forwardAaBbCcDdE AABBCCDDE AaBbCcDc AaBbCcDdEe v A v Normal No Spacing Heading 1 Heading 2 Activity 4 You isolate a bunch of different mutants, all in the same gene, that effects body length in your model genetic organism. You have organized your observations in the table below. Wild type length Length of heterozygotes Length of homozygotes Mutant 1 2 cm 1.5 cm 1 cm Mutant 2 2 cm 1 cm 1 cm Mutant 3 2 cm 1.5 cm 1 cm Mutant 4 2 cm 2 cm 1 cm 1. Which of the above is a recessive mutation? 2. Which of the above is a Dominant mutation? 3. Mutants 1 and 3 have very similar results, but there are 2 types of dominate mutations that can cause this? What are they and how will you distinguish between them? stv Ps X w 888 DII DD F4 F5 F6 F7 F8 F9 F10 % & * ) 5 6 7 8 9arrow_forwardTHE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…arrow_forward
- THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67arrow_forwardstion 6 of 18 Suppose that a geneticist discovers a new mutation in Drosophila melanogaster that causes the flies to shake and quiver. She calls this mutation quiver, qu, and determines that it is due to an autosomal recessive gene. She wants to determine whether the gene encoding quiver is linked to the recessive gene for vestigial wings, vg. She crosses a fly homozygous for quiver and vestigial traits with a fly homozygous for the wild-type traits, and then uses the resulting F, females in a testcross. She obtains the flies from this testcross. Phenotype Number of flies vg* qu+ 230 vg qu 224 vg qut vg* qu 97 99 Test the hypothesis that the genes quiver and vestigial assort independently by calculating the chi-squared, X², for this hypothesis. Provide the X2 to one decimal place. X2 = Does the X value support the hypothesis that the quiver and vestigial genes assort independently? Why or why not? the partial table of critical values for X2 calculations to test this hypothesis.arrow_forwardWhy are some genes expressed and some not? Please be as detailed as possible.arrow_forward
- Interested in exploring the genetic pathways that lead to neurological issues, you want to see if recessive mutations which generate too many neurons (tm) in flies - which many causes autistic like symptoms are in the same gene as mutations that generate too few neurons (tf) - intellectual diabilities. You cross a true-breeding homozygous tm/tm fly to a homozygous too few neuron fly tf/tf. What phenotype in the progeny would tell these mutations are in different genes?arrow_forwardAaBbCc x AaBbcc How would you characterize this kind of relationship between the genes: A-B- (gray); A-bb (yellow); aaB- (black); aabb (cream) The CC and Cc genotypes allow color according to the expression of the A and B alleles. However, the cc genotype results in albino rats regardless of the A and B alleles presentarrow_forwardNeed explanation on #4 of my genetic questionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY