Microbiology Fundamentals: A Clinical Approach
3rd Edition
ISBN: 9781259709227
Author: Marjorie Kelly Cowan Professor, Heidi Smith
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 4, Problem 1VC
From chapter 2, figure 2.1. Discuss how the techniques of the Five I’s of
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario.
Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote?
You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab.
What is one experiment you could do, involving culturing the organism?
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario.
Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote?
You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab.
What is a procedure you could do, involving making a slide of the organism?
You are working for the CDC studying outbreaks of foodborne infectious disease. Your latest case is
an incidence of food poisoning in a fast food restaurant. 5 people have been hospitalized for food
poisoning, so you are working with that hospital to identify the source of the outbreak.
Hospital clinicians have taken samples from each of the 5 patients for culturing. Each bacterial
culture grew one likely microbe, each labelled P1, P2, P3, P4, and P5. All 5 isolates appear to have
the same colony morphology on the plates, and all appear to be Gram-negative rods 1 micron wide
and 3 microns long under the microscope. In addition, all 5 isolates appear to perform the same on
an API 20E test strip that tests bacteria for 20 biochemical abilities. No other testing has been done
yet.
How would you best describe your set of isolates at this moment?
O Each isolate is the same strain, of a different species
O Each isolate is a different strain, of different species
O Each isolate is a different…
Chapter 4 Solutions
Microbiology Fundamentals: A Clinical Approach
Ch. 4.1 - Relate bacterial, archaeal, and eukaryotic cells...Ch. 4.1 - List the types of eukaryotic microorganisms, and...Ch. 4.2 - Differentiate among the flagellar structures of...Ch. 4.2 - List similarities and differences between...Ch. 4.2 - Describe the main structural components of a...Ch. 4.2 - Diagram how the nucleus, endoplasmic reticulum,...Ch. 4.2 - Prob. 7AYPCh. 4.2 - Explain the importance of ribosomes, and...Ch. 4.2 - List and describe the three main fibers of the...Ch. 4.2 - Prob. 10AYP
Ch. 4.2 - Prob. 1NPCh. 4.3 - Prob. 11AYPCh. 4.3 - Prob. 12AYPCh. 4.3 - Differentiate among the terms heterotroph,...Ch. 4.3 - Prob. 14AYPCh. 4.3 - Prob. 15AYPCh. 4.3 - Q. Yeast infection is one common side effect of...Ch. 4.3 - Prob. 2MMCh. 4.4 - Prob. 16AYPCh. 4.4 - Prob. 17AYPCh. 4.4 - Explain why a cyst stage may be useful to a...Ch. 4.4 - Prob. 19AYPCh. 4.4 - Prob. 2NPCh. 4.5 - Prob. 20AYPCh. 4.5 - Summarize the stages of a typical helminth life...Ch. 4.5 - Prob. 3NPCh. 4.5 - Prob. 3MMCh. 4 - Mitochondria likely originated from a. archaea. b....Ch. 4 - Summarize the endosymbiotic theory and explain how...Ch. 4 - Prob. 3QCh. 4 - Prob. 4QCh. 4 - Compare and contrast the structure and function of...Ch. 4 - Prob. 6QCh. 4 - Prob. 7QCh. 4 - Considering the role of fungi in nature, speculate...Ch. 4 - Prob. 9QCh. 4 - Prob. 10QCh. 4 - Prob. 11QCh. 4 - Prob. 12QCh. 4 - Prob. 13QCh. 4 - Prob. 14QCh. 4 - Do you suppose any of these eukaryotic microbes...Ch. 4 - Which of these groups causes the most casualties...Ch. 4 - Prob. 17QCh. 4 - Do you suspect that the fact that humans use...Ch. 4 - Which of the following is not useful to determine...Ch. 4 - Why were protozoa originally considered a single...Ch. 4 - Write a paragraph that would explain the...Ch. 4 - From chapter 2, figure 2.1. Discuss how the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Discuss how the techniques of the five I's of microbiolgy would be completed if your parent's infection was due to a protocols, a eukaryotic microbe. Add citationsarrow_forwardA professional microbiologist is least likely to study which of the following organisms? A large bacterium like Epulopiscium fishelsoni that is visible to the naked eye A small single-celled eukaryote like Plasmodium falciparum Pyrococcus furiosus, an extremophilic Archaeon Human egg and sperm cellsarrow_forwardMedical Microbiology Give your own synthesis (using key words or phrases and presented using a flow chart or a schematic diagram) of the complexity and dynamics of microbial disease development.arrow_forward
- I need help answering this question to my professor: The topic for the discussion was this one: Some potentially pathogenic bacteria and fungi, including strains of Enterococcus, Staphylococcus, Candida, and Aspergillus, can survive for one to three months on a variety of materials found in hospitals, including scrub suits, lab coats, plastic aprons, and computer keyboards. What can hospital personnel do to reduce the spread of these pathogens? My answer was this one: To reduce the spread of these pathogens an infection control protocol should be followed. Some ways in which this could be reduced is by using desinfectants, sterilization, hand washing, and disposing techniques. In addition, I currently work as a dental assistant at Jackson Main and the protocol we use is hand washing our hands for at least 20 seconds before and after seeing every patient. We use CaviWipes to disinfect every surface and autoclave every single instrument after every use. Also, we make sure to…arrow_forwardWhat factors do you think must be considered when treating an infection present in a biofilm on a medical implant (e.g., an artificial hip) versus a skin infection caused by the same microbearrow_forwardselect a microbe that has proven to be either environmentally or socially beneficial to human beings. You are not restricted to bacteria, but the organism chosen must be considered a microbe. In your post, include an explanation of the microbe's discovery, its use (either environmentally or socially), and its normal habitat. You should cite your researcharrow_forward
- go to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…arrow_forwardHistory may not be your favorite subject, especially learning about a bunch of long-dead scientists who made discoveries that we now take for granted. With an open mind, you may actually find the information interesting and learn a few things you didnt know before. During your examination of the topics in this chapter, consider the following: Which pioneers of microbiology had the biggest impact on surgical patient care?arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forward
- In An Aseptic Technique, what are the uses of bunsen burners in the working area when performing a microbiological experiment? What equipment is used to accelerate the growth of microorganisms in the experiment? (b) What is the setting of the equipment and explain briefly the reason behind the setting?arrow_forwardWhich of the following is NOT true about Koch's postulates? First developed by Robert Koch, the pioneering German microbiologist In the first step, the microbe that causes a naturally occurring disease is cultured from a "wild" (non-laboratory) animal which has that disease None of the other four answers (All are true about Koch's Postulates) They represent a process for showing a causal association between a specific microbe and a disease If the same microbe from a diseased "wild" (non-laboratory) host causes the same disease in a lab animal and it can be cultured from that lab animal, this proves that the microbe is the cause of the naturally occurring diseasearrow_forwardHow does the streak plate technique help in isolating individual colonies of bacteria? Why streak multiple times on one plate? 3. While observing a plate inoculated with bacteria you observe a white-tan fuzzy growth. What can you interpret from this observation? Explain how this outcome could’ve occurred. 4. What are 3 possible errors that could take place as you culture your samples which could lead to contamination? State 3 and explain why. Microbiology classarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Microbiology for Surgical Technologists (MindTap ...
Biology
ISBN:9781111306663
Author:Margaret Rodriguez, Paul Price
Publisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY