BIOCHEM. II-EBOOK ACCESS>CUSTOM<
BIOCHEM. II-EBOOK ACCESS>CUSTOM<
18th Edition
ISBN: 9781337700320
Author: GARRETT
Publisher: CENGAGE LEARNING (CUSTOM)
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 30, Problem 1P
Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Expert Solution & Answer
Check Mark

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
Genome for C. diphtheriae have about 2,500,000 nucleotides, 87% of them are coding. This ingle circular chromosome contains 2,389 genes from which 2,272 proteins are coded. It does not contain any plasmids. The genome contains Pathogenicity Islands (PAIs), which C. diphtheriae has 13.  What is a PAI and what are their characteristics?
Give only typing answer with explanation and conclusion  The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally located 8 base pairs upstream of the start codon AUG. The complementary sequence (CCUCCU), is called the anti- Shine-Dalgarno sequence and is located in another cellular nucleic acid. Which one? The antisense strand of DNA of the translated gene   The 23S rRNA   The fMet-tRNA   The 5S rRNA   The 16S rRNA
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License