Q: Alchohol based hand sanitizers are effective against influenza. True/False?
A: Influenza is a viral infection caused by the influenza virus. It is commonly known as flu. There are…
Q: Create a dichotomous flow chart with the result as streptococcus aureus using the provided tests and…
A: *streptococcus aureus is a Gram positive and round shaped bacterium which belongs to a member of…
Q: What method is best for for isolating a colony on a TSA plate? A. Swab plate B. Straight line…
A: An isolated colony represents a pure source of an organism from which a pure culture can be started.
Q: For Staphylococcus aureus, indicate which tests need to be done & what media you need. Fill in box…
A: Staphylococcus aureus is a spherical-shaped cocci that belongs to the family of Firmicutes. It is…
Q: Differentiate the following artificial media used in animal cell culture: serum-containing media…
A:
Q: Figure 1. Cytotoxicity test on 96 well plates that was monitored by ELISA reader 3- Discussion 1-…
A: The degree to which a substance can harm a cell is referred to as its cytotoxicity. Cytotoxic refers…
Q: Explain why the following steps are essential during subculturing:a. Flaming the inoculating…
A: A microbial culture made by transferring the cells from the previous/old culture medium into a fresh…
Q: Match the test with a positive result a. DNA test b. Paper chromatography test c. Celllar…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: In a Kligler Iron Agar/Triple Sugar Iron test you end up with a result with a yellow butt and red…
A: When a non-lactose fermenting bacterium hydrolyses the agar slant in the Kliger Iron Agar/ Triple…
Q: Enumerate the Aim of blood smear
A: The blood smear is a test used to find abnormalities in blood cells.
Q: Choose the best combination of depyrogenation methods: 0.45 um filtration +0.22 µm filtration…
A: Introduction Pyrogens are the substance that causes pyrexia( a type of fever). The gram-negative…
Q: List at least 10 laboratory tests that use whole blood as a test sample.
A: 10 laboratory tests that use whole blood as a test sample.
Q: Negative Control Unknown Isolate
A: Blood agar comes as a basal media and can be used as a general growth medium. Blood agar is an…
Q: You counted 40 colonies on a plate in your dilution series. The plate was inoculated with 1.0ml from…
A: A microbial sample will have enormous amount of cells. To estimate this by calculation, the sample…
Q: Describe how an ELISA test is performed, how the test works and provide examples of ELISA tests.
A: ELISA is an Enzyme-Linked Immunosorbent Assay, which is used to detect antibodies or antigens in the…
Q: Briefly explain the shake-tube inoculation
A: Inoculation is the key process in the microbiology in which inoculum is extracted.
Q: Can culture media be sterilized in the hot air sterilizer? Why or why not? (Answer in not more than…
A: Sterilization is defined as a process by which an agent is used to destroy or remove the…
Q: You are provided with a mixed culture of Escherichia coli and Pseudomonas aeruginosa, draw a flow…
A: Escherichia coli and Pseudomonas aeruginosa both are gram negative bacteria that can cause severe…
Q: You saw no color change in both the first step and second step of the Nitrate Reduction test. What…
A: A nitrate reduction test is a test done to test whether the Enterobacteriaceae member produces the…
Q: The best medium for using antibiotic susceptibility testing is _________________, the reason why…
A: Antibiotic susceptibility test is basically used to measure the ability of an antimicrobial agent or…
Q: explain a Competitive ELISA image and explain it
A: Competitive ELISA is most commonly used for antibody detection. In this type of assay, the antigen…
Q: Citrate test Explain what is the color of the medium after incubation? Green or blue
A: To correctly identify a microbial species, we make use of various biochemical assays that have…
Q: In routine stool examination, what is a Floatation Technique? a.) What the procedure is used for…
A: Hello, as your question has many parts, we will only answer the first three parts for you and if you…
Q: Explain at least one way you could have a false positive, and a false negative in the HHMI ELISA for…
A: ELISA or enzyme-linked immunosorbent assay is an immunological assay used to quantify or detect the…
Q: Explain how staphylococcus capitis test is different from streptococcus salivarius test ?
A: Streptococcus salivarius and Staphylococcus capitis are both pathogens for humans. These two…
Q: in the document you submit, please describe the results for this test… (like yellow equals what?)…
A: Methyl Red and Voges-Proskauer (MRVP) Test is used to find which fermentation pathway was used to…
Q: purpose of using serum in culture media
A: A culture media is a media made in the lab, that is curated to facilitate the culture and growth of…
Q: Explain how to conduct a Kirby-Bauer disk diffusion test. Include all of the steps involved
A: INTRODUCTION Kirby - Bauer Disc diffusion method Kirby - bauer disc diffusion method is widely known…
Q: What test can help you differentiate staphylococci from streptococci? What reagent or media would be…
A: Both are gram positive bacteria.
Q: Agar was not completely set prior to inoculating with the organism. Effect: Rationale:
A: Bacterial cultivation requires specific types of medium that can provide some of the basic…
Q: Based on this data, complete the table below: Plate # Dilution in Test Tube Inoculum Volume Titer…
A: Here the stock solution is an unknown concentration and the plague plates are developed in only 3…
Q: Give the full form of ELISA.which disease can be detected using it?Discuss the principle underlying…
A: It is a diagnostic tool for detecting substance like antigen.The rDNA technology has enabled the…
Q: Microorganism that has the urease enzyme present a O red (or pink) O yellow (or peach) color in the…
A: The Urease test had been developed by the microbiologist Christensen. This test is used particularly…
Q: Many vaccines are heat sensitive due to their high concentration of proteins. Which of the following…
A: A heat sensitive vaccine is one which if exposed to temprature above certain specific values will be…
Q: What test best matches the image below? O Novobiocin O ELISA O DNA hydrolysis O MSA
A: DNA hydrolysis test or DNase test is commonly performed test to check the ability of the organism to…
Q: What two S. aureus antigens are being detected with the use of this test kit?
A: Antigen is a substance that is capable of stimulating an immune response. Specifically, it activates…
Q: Between Bacillus megaterium, Bacillus sphaericus, and Bacillus subtilis which are positive or…
A: The VP test detects organisms that utilize the butylene glycol pathway and produce acetoin. It…
Q: When is the best time to collect a specimen for bacterial culture? A. acute phase of disease C.…
A: Introduction :- Bacterial growth occurs when a bacterium divides into two daughter cells, a process…
Q: Below is a picture of ELISA results. Why is the color darker in some wells and lighter in others?…
A: Biochemical tests are those that are used for the detection of different bacterial species based on…
Q: Under what conditions is sterilization by filtration preferred over sterilization by heat
A: Filteration is the sterilization process wherein there is the physical removal of micro-organisms…
Q: discuss why a mixed culture cannot be used to inoculate a differential media such as the tripple…
A: A mixed culture is one that contains more than one type of organism growing in a sterile medium. The…
Q: Describe results from a coagulase, DNase, and novobiocin test that would suggest a mixed culture was…
A: Staphylococci are Gram-positive spherical bacteria that occur in the form of grape-like clusters.…
Q: In the entrropluri tube system which test require the addition of reagents after the incubation time…
A: Entreropluri test system is a Enterobacteriaceae identifying system. It is use to identify some gram…
Q: n routine stool examination, what is the "Scotch Tape" Method? Guide: a.) What the procedure is…
A: In hospitals or healthcare centers, a stool test is done to diagnose any condition that affects the…
Q: In product testing, no colonies appeared. Interpretation: Rationale:
A: Ans: Product testing: The product testing is performed as a regular quality control protocol in…
Q: Which of the following methods is most sensitive for identifyingdifferent strains of a microbe?a.…
A: Microorganisms or microbes are small living organisms that can be observed with the aid of…
Q: What are the areas of medical importance where animal inoculation can be useful
A: Animal inoculation- Animal inoculation means introduction of pathogens or antigen into animals to…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- QUESTION 5 Based on the plasmid shown, what will you have to use to to distinguish and isolate the bacteria that successfully took up the plasmid? O Lactose O Tetracycline O Ampicillin O UV light to identify the glowing colonies O XgalQuestion 15 Juan used the ABO blood testing kit to determine his blood type. His test showed the following anti-A anti-B anti-D + means agglutination was observed - means no agglutination was observed What is Juan's blood type? O A- A+Question 13 Maria used the ABO blood testing kit to determine her blood type. Her test showed the following anti-A anti-B anti-D + means agglutination was observed - means no agglutination was observed What is Maria's blood type? AB+ O - O A+ AB-
- Question 12 O antigen is a base oligosaccharide that is present in both A and B antigen. True O FalseQuestion 13 The reason Toq polymerase is specifically desirable for use in PCR is that it does not (itself) denature at the high temperatures necessary to denature DNA. O True O FalseQuestion 2 A spreader was used to 1. to uniformly disperse bacteria across the surface of the agar 2. to transfer bacteria from the test tube to the agar plate 3. to simulate mutations for antibiotic resistance 4. to disperse the antibiotic
- Question 39 Forensic biology is historically also known as screening HLA Dqa ABO typing serology DNA profilingQuestion 5  Antibiotic resistance might be assumed if 1. bacterial colonies are present on a streptomycin negative plate 2. bacterial colonies are present on a streptomycin positive plate 3. bacterial colonies are absent on a streptomycin negative plate 4. bacterial colonies are absent on a streptomycin positive plateQUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
- QUESTION 10 Remdesivir is converted in vivo to CMP analog and then phosphorylated to CTP analog. a successful treatment for Ebola. There are more than 1 correct answers in the other choices. a potential chain terminator for the replication of RNA viral genomeQuestion 42 To determine whether or not a bloodstain is of human origin, the serologist will perform amylase testing a PSA test the acid phorphatase test a HemaTrace test the luminol testQUESTION 1 SDS-PAGE reagents that play a role in formation of the gel only are(Select all that applies) Beta-Mercaptoethanol Bromophenol blue APS Heat Sodium Dodecyl Sulfate Bis-acrylamide Acrylamide TEMED 3.33 points QUESTION 2 In Lab 3 we aimed to separate lysozyme from the Hen egg white proteins. Which of the following is the correct observation/result from that lab? Load contains all the neutral and negatively charged proteins. HEW contains negative and neutral proteins only. Carb 1 contains negatively charged proteins. Load contains positive, negative and neutral proteins. 3.34 points QUESTION 3 In order to separate negatively charged proteins from a mixture of neutral, positively charged and negatively proteins, you should pass the mixture of these beads through Gel filtration column, using anion…