Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap Addition of the 3’ poly A tail Splicing to remove exons and connect the retained introns Splicing to remove introns and connect the retained exons

Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap Addition of the 3’ poly A tail Splicing to remove exons and connect the retained introns Splicing to remove introns and connect the retained exons

Name: Which one of the following options is NOT a step in RNA processing?Add
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which one of the following options is NOT a step in RNA processing?Addition of the 5’ G capAddition of the 3’ poly A tailSplicing to remove exons and connect the retained intronsSplicing to remove introns and connect the retained exons

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
Which of the following processing events occur during or after the synthesls of MRNA molecules in eukaryotes? Intron splicing Addition of a 5'cap O Cleavage of multiple functional molecules from a larger precursor O Polyadenylation of the 3' end
he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).
015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAG
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the sequence to give it a missense mutation. Circle/highlight the mutation. Explain how your specific mutation would affect the formation and structure of the 2nd (middle) Base of a Codon 1st U CA G 3rd Base Base UUU Phe UUC Phe UUA Leu UUG Leu UCU Phe UCC Phe UCA Leu UCG Leu UAU Tyr UAC Tyr UAA STOP UAG STOP UGU Cys UGC Cys UGA STOP UGG Trp protein. U CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro ССС Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg AAU Asn AAC Asn AUU lle AUC lle AUA lle AUG Met ACU Thr ACC Thr ACA Thr ACG Thr A AAA Lys AAG Lys GUU Val GUC Val GUA Val GUG Val GCU Ala GCC Ala GCA Ala GCG Ala GAU Asp GAC Asp GAA Glu GAG Glu GGU Gly GGC Gly GGA Gly GGG Gly UCAG
Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion