Which of the following would typically be the initial indicator of bacteria growing within a blood culture tube? O An automated incubator will detect fluorescence. Bacterial colonies will appear on MacConkey agar. Bacterial colonies will appear on blood agar. O Centrifugation will cause sediment to appear at the end of the tube.
Q: In autosomal dominant disorders, the recurrence risk is ¾(75%) when one affected parent and one…
A: When a child receives one version of a mutant gene from one parent, autosomal dominant inheritance…
Q: Your next-door neighbor has donated $100 in support of cancer research and is horrified to learn…
A: Yeasts are eukaryotic, single-celled microorganisms delegated individuals from the parasite kingdom.…
Q: Explain why end product inhabitionvi is usually if an enzymesat the start of reaction sequence
A: An allosteric effector generated as the biosynthetic pathway's end product normally controls the…
Q: The Age of Reptiles corresponds to the (a) Paleozoic era (b) Mesozoic era (c) Cenozoic era (d)…
A: Molecular systematics assists biologists in interpreting fossil records to infer animal evolution.…
Q: Which are thought to have evolved first, aerobic bacteria or photosynthetic bacteria? Explain.
A: There are two main types of bacteria, aerobic and anaerobic. Aerobic bacteria need oxygen to…
Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…
A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…
Q: Why can alcohol kill bacteria? Explain via proteins.
A: Alcohol kills bacteria through The process called as denaturation. Denaturation takes place when…
Q: The following question refers to the neural circuit below. Excitatory synapses are represented by…
A: Neurons are the basic unit of nervous system
Q: Could hawthorn and apple maggot flies be considered an example of assortative mating? Explain your…
A: Assorting mating is a type of mating in which the organism mates with another organism that has…
Q: Can you think of one organism not mentioned in thischapter as a keystone species that you believe…
A: Species are described using the biological species concept. These species are the fundamental units…
Q: Which of these are known to host chemosynthetic communities? a) Hydrothermal vent O b) Hydrocarbon…
A: The food chain in our ecosystem depends on the primary producers as they are capable of harvesting…
Q: In our circulatory system, ome of the blood protection function is Preventing Blood loss. Explain…
A: Introduction: Blood is a connective fluid that contains both cells and fluids. Red blood cells (or…
Q: (i) Why are both differentiation and self-renewal essential for the functioning of stem cells in the…
A: i) Stem cells are those cells which are responsible for the formation of different type of cells…
Q: What is the significance of step-wise release of energy in respiration?
A: In biology, respiration is defined as the process of converting oxygen into carbon dioxide and water…
Q: Where did eukaryotes come from?
A: Introduction The origin of life on earth can be traced back to 3.4 billion years ago and as we now…
Q: discuss the relative advantages and disadvantages of light and electron microscopy. how could you…
A: A microscope is a device used to observe microscopic organisms that are invisible to the naked eye.…
Q: Which of the following models of sexual selection may result in phenotypes that are not beneficial…
A: Sexual selection is the process by which certain organisms produce more offspring by mating more…
Q: Question 8. What method can be used to compare the transcriptomes of individual single cells?
A: Cell- the smallest unit which can live on its own and makes up all living tissues of the body. It…
Q: What, if any, are the advantages in being multicellular?
A: Multicellular organisms are those which has more than one cells in their body. Animals, trees and…
Q: In circulatory system, one the main function of our blood is maintaining pur body pH Explain further…
A: The circulatory system is responsible for transporting blood around the body. It consists of the…
Q: Name and describe the three domains of living organisms
A: The three domain system is a biological classification introduced by Carl Woese. This system is…
Q: Write note on the circled events of the excitation contraction coupling shown in the diagram below.…
A: The diagrammatic representation shows the process of cardiac excitation contraction coupling. This…
Q: What is the significance of atrio-ventricular node and atrio-ventricular bundle in the functioning…
A: Introduction Significance of atrioventricular node and atrioventricular bundle in the functioning of…
Q: species’ population dynamics
A: Population Dynamics is related to ecology ( study of living organisms with relation to…
Q: Which component of cell division machinery is frequently targeted by anti-cancer drugs? Can you…
A: INTRODUCTION Cancerous tumors are characterized by uncontrolled cell division, which is absent in…
Q: If a parent cell has a haploid number of 8, how many sister chromatids will be present after S phase…
A:
Q: They have pol 8 and pol e They do not need to export the transcript out of a nucleus They add a 5'…
A: INTRODUCTION Prokaryotes are single-celled organisms. Due to the absence of internal membranes,…
Q: Ap Normal No Spacing Head 目三。、田 Paragraph Styles 1. You heve a circuler plasmid (pUC57), which…
A: We are allowed to do one or upto three subpart of a question. Please repost the undone question…
Q: What method can be used to compare the transcriptomes of the individual single cells?
A: A transcriptome is a range of mRNA molecules that are expressed by an organism. It is a term that…
Q: Why do we call our heart myogenic?
A: Introduction In this question we will discuss why our heart is called myogenic.
Q: Related species of terrestrial animals typically display allometricrelations between body-water…
A: In the system of the well-known term which is used to define the broadest sense, allometry describes…
Q: By now you should be familiar with the following cellular components. Briefly define what they are…
A: Hi! Thank you for the question. As per the conduct code we will answer only the first three parts.…
Q: Sino-atrial node is called the pacemaker of our heart. Why?
A: Introduction In this question we will discuss why Sino-atrial node is called the pacemaker of our…
Q: 19.As observed in animal stem cells, plant meristems are able to? Read and analyze the question and…
A: Stem cells These cell are special cell that have potential to develop into any kind of cell or…
Q: In your point of view as a senior high school stem student, How will you raise an awareness on the…
A: Hypertension : It is the increase of the arterial blood pressure of blood exerted on the wall of…
Q: с. b. A+B e. a. C+D Progress of the Reaction Free Energy d.
A: A reversible reaction is a chemical reaction where the reactants form products that, in turn, react…
Q: Why do we consider blood as a connective tissue?
A: Connective tissues have cells scattered all over the extracellular matrix.
Q: e at least five different deficiency symptoms in plants. Describe them and correlate - with the…
A: Since the inorganic elements required by the plants are cheifly obtained from the soil where they…
Q: Why do we consider blood as a connective tissue?
A: Extracellular matrix (ECM) connective tissues contain cells that are dispersed throughout the…
Q: Is it proper to list genus in this way in the example sentence below? The potential identity of the…
A: The binomial nomenclature system is a formal and official way of naming living organisms. As the…
Q: 5. Wild animals leave their habitat due to the conversion of forests to techno park. * A.…
A: A limiting factor is a kind of facfor that can aim in population size and can slow down the growing…
Q: Research and describe Georgy Gause’s P. caudatum and P. aurelia experiment.
A: INTRODUCTION In ecology, the competitive exclusion principle, often known as Gause's law, states…
Q: Problem 7: Consider three neuron nodes: S1, S2, and S3 with thresholds T1, T2, and T3 given as…
A: A potential energy surface (PES) describes the potential energy of a system, especially a collection…
Q: is DNA replication called semiconservative? A. Both daughter strands are entirely new B. Each…
A: Replication of DNA is very important for the transmission of chromosomal DNA from one generation to…
Q: The optometrist asked Garreth Bale to close his right eye and focus on the tip of his pen while she…
A: ANSWER) (3) accomodation and convergence As the Greth Bale is not comfortable when the optometrist…
Q: 1. Refer to the figure. Which of the following statements is incorrect? 35 30 25 20 10 5 Visual…
A: Neurons are the structural and functional unit of brain and the nervous system. They receive signals…
Q: 6- BRAIN • Neural prostheses are a series of devices that can substitute a motor, sensory or…
A: In the above question, the student has asked to summarise the given topic as it have not mention…
Q: What does DNA polymerase need in order to make contact with a replication origin
A: The replication of DNA is the process that is mediated by several enzymes and additional proteins.
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Which of the following has an indirect economic value? * A. Animal skin used as belt B.…
A: Economic value is one of many possible ways to define and measure value. Although other types of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A bacterial culture has a concentration of 3.2 x 108 cells /mL. You dilute this culture as follows: 1/50, then 10-3and finally 1/20. If you then plate 0.2 mL of the final dilution, how many CFU would you expect following incubation?A pure bacterial culture of unknown concentration was diluted to determine the concentration of viable bacteria in the original culture. Serial dilutions were performed as 2. diagrammed below. A volume of 500 µl was transferred into each tube. TSA plates were inoculated with 100 µl from the last three dilution tubes. a. If the dilution between each tube is 102, what is the volume of diluent in each of the 5 dilution tubes? Provide the volume using ml as the units. b. What is the total dilution of tube number 4? Express the total dilution using scientific notation. c. What is the concentration of viable bacteria in the original culture? Express the concentration using scientific notation and CFU/ml as the units. d. If you inoculated a TSA plate with 1.0 ml from dilution tube 4, how many colonies would you expect to form on the plate after incubation? e. If the original culture had a volume of 50ml, what was the total number of viable bacteria in the 50 ml of the original culture? 1 2 3…procedure/s in performing aseptic transfer of bacterial cultures in (include illustration) (2) agar slant culture to agar slant
- 1:07 < Вack Untitled 6 Brownian movement of bacteria: O a. Can be observed by the of soft agar technique O b. Can be observed by staining of Staphylococcus aureus Oc. Is common in Escherichia coli or Proteus vulgaris O d. Is common in Staphylococcus aureus O e. Can be observed at the edge of a microscope CLEAR MY CHOICEFive ml of bacterial culture is added to 45 ml of sterile diluent. From this suspension, the following serial dilutions were made, two 1:100 and one 1:10 dilutions, and 0.1 ml is plated onto Plate Count Agar from the last dilution. After incubation, 186 colonies were counted on the plate. 1. What is the dilution factor, or how much of the original sample was diluted?Determine what percentage of the culture was living (viable) and what percentage was dead (mortality). Plates Plate Dilution Volume plated No.of colonies Avg No Concentration of diluted sample Cd(cells/mL) Concentration of original sample Cu(cells/mL) 1 10^-3 10ul R1=130,R2= 110,R3=210 150 150mL 1.50*10^6 Volume of cells(mL) Volume of diluent(mL) Total dilution(D) Hemocytometer count Avg cells in 1 mm^2 area Concentration of diluted sample Cd(cells/mL) Concentration of original sample Cu(cells/mL) 4.3 0.5 0.1 grid 1= 171 , grid2 = 185 178 1.78*10^5 1.78*10^6
- You are given a bacterial culture which has a concentration of approximately 5.0 x 10^8 cells/mL. List a series of dilutions and platings that you could carry out in order to determine the exact concentration of the culture. Note that you must plate four plates from a minimum of two dilution tubes. The volumes plated should be in the range of 0.1 mL – 1.0 mL. Duplicate volumes may not be plated from any one dilution tube. Each plating should aim for a count between 30 and 300 CFUs. You can select any value from 30-300 for CFU and any volume from 0.1-1.0 to find out dilution schemeThe number of bacterial cells in a culture broth is to be determined by a culture technique. Serial dilutions were performed and a 0.1 mL aliquot from each dilution was spread onto Plate Count Agar (PCA). The number of bacterial colony forming units (CFU) after overnight incubation are shown as listed in the table below. What is the number of colony forming units per mL of the culture broth? Choose only the most appropriate plate for your calculation. Give your answer as the number only (do not add text for the units). You may use scientific notation with the format 1.12e+6 (that is, 1.12 x 106 cfu/mL). (Note: Canvas will then display your answer a whole number.) Plate 1 10 Plate 2 10 Plate 3 10 dilution dilution dilution Plate 4 10 dilution Plate 5 107 dilution Plate 6 10 dilution -6 *Too many to count Number of colony forming units (CFU) TMTC* TMTC* 840 28 19 1A tampered sack of powdered milk was analyzed by getting 50 grams of composited sample and diluting it with 450 ml of sterile distilled water. One ml and 0.1 ml of sample suspension were inoculated in 50 ml Dextrose Tryptone Bromcresol Purple agar and were heated at 100˚C for 5 minutes. Each flask was poured into 3 plates. After the incubation, opaque colonies surrounded by a yellow halo in purple field were counted. The following counts were obtained from the plates: 95, 107, 92, 26, 28 and 27. Compute for the total spore counts and express your final answer per 50 grams of the powdered milk sample.
- Assuming that serial dilution was carried out in a laboratory experiment in 6 tubes with 9 ml of saline in each tube and 0.1ml of the stock solution was used for initial dilution, pour plate method of inoculation was performed after the dilution process using 1ml of the culture from the samples from the test tubes. It was found out that on the 6th Petri dish after incubation, there was a total of 16 individual colonies counted. Compute the total number of microorganisms present in tube one, assuming that there was no human error in the transferring proces.The number of bacterial cells in a culture broth is to be determined by a culture technique. Serial dilutions were performed and a 0.1 mL aliquot from each dilution was spread onto Plate Count Agar (PCA). The number of bacterial colony forming units (CFU) after overnight incubation are shown as listed in the table below. What is the number of colony forming units per mL of the culture broth? Choose only the most appropriate plate for your calculation. Give your answer as the number only (do not add text for the units). You may use scientific notation with the format 1.12e+6 (that is, 1.12 x 106 cfu/mL). (Note: Canvas will then display your answer a whole number.) Plate Dilution Plate 1 10 dilution Plate 2 10 dilution Plate 3 107 dilution Plate 4 10 dilution Plate 5 107 dilution Plate 6 100 dilution *Too many to count Number of colony forming units (CFU) TMTC* 382 83 10 2 0assuming that serial dilution was carried out in a laboratory experiment in 6 tubes with 9 ml of saline in each tube and 0.1ml of the stock solution was used for initial dilution, pour plate method of inoculation was performed after the dilution process using 1ml of the culture from the samples from the test tubes. It was found out that on the 6th Petri dish after incubation, there was a total of 16 individual colonies counted. Compute the total number of microorganisms present in tube one, assuming that there was no human error in the transferring process.