What is true about the geographic context of trees and keys? a. Neither phylogenetic trees nor dichotomous keys tend to be restricted to certain geographic areas b. Usually, phylogenetic trees but not dichotomous keys are restricted to certain geographic areas c. Both phylogenetic trees and dichotomous keys tend to be restricted to certain geographic areas d. Usually, dichotomous keys but not phylogenetic trees are restricted to certain geographic areas

Q: Explain how meiosis and fertilisation produce variation within a population.

A: There are several factors that contribute to genetic variation in populations. Natural genetic…

Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…

A: In transcription, the template strand is the strand of DNA that serves as the template for the…

Q: When a true null hypothesis is rejected in a hypothesis test, the researcher or analyst has A.…

A: The collection of methods in biology known as "experimental biology" focus on using experimentation…

Q: Endothermic creatures maintain fairly consistent body temperatures. Ectothermic creatul…

A: Introduction  Homeostasis refers to the state in which a system's components—variables and…

Q: Please draw the mature mRNA that is capable of leaving the nucleus.  As you draw this think about…

A:

Q: Suppose your cells are missing an organelle. Pick an organelle and research what would happen to…

A: Organelles are the entities present inside the cell performing different functions. A cell contains…

Q: Draw the current changes caused by a single voltage gated Potassium channel when the membrane is…

A: Voltage gated potassium channels are protein channels that open or close in response to changes in…

Q: 9. This diagram is of a mitochondrion. Which letter indicate the structure where ATP synthase is…

A: "Since you have asked multiple questions, we will solve few question for you.If you want any…

Q: estions 1-2: Describe an appropriate control for each of the following. An investigator studies the…

A: In an experiment control is used when the independent variable is removed or set at standard value.…

Q: If there are 24 chromosomes in a somatic cell in the Gap 1 of the cell cycle, what is the diploid…

A: Somatic cells are haploid.somatic cells compose the body of the organism and undergoes the process…

Q: 4. The punnett square below shows brown eyed mom and blue eyed dad. Complete the punnett square…

A: A Punnett square is a graph that makes it simple to ascertain the predicted proportion of various…

Q: What conclusions can be drawn from the table ?

A: Introduction- The Cardiac CycleRefers to the events of 1 complete heart beat- Both atria &…

Q: Which of the following is NOT true of ionic bonds? They are formed because of the mutual attraction…

A: Ionic bond is also known as electrovalent bond. It is the complete transfer of valence electrons…

Q: A scientist is evaluating the effects of soil nitrogen levels of chlorophyll concentration in…

A: Chlorophyll is the pigment that makes the plant green in color. Photosynthetic activity of the plant…

Q: what are the 3 scientific names for e coli bacteria and cactus

A: Scientific name are the names of living species derived from binomial naming system. The names are…

Q: Which of the following helminths is known as the hookworm? Strongyloides stercoralis Trichuris…

A: Hookworms generally are blood-feeding, parasitic roundworms that can cause various kinds of…

Q: hybrid has two different genes for a given trait a. True b. Fasle If B indicates tallness then an…

A: Introduction :  A single cell divides twice to form four cells during the meiosis process. The…

Q: 1. Pertussis, also known as whooping cough, is a communicable disease in humans. It is caused by the…

A: a) Small quantities of purified proteins from the whooping cough bacteria are used in modern…

Q: create a null hpothesis

A: Hypothesis  are an important aspect of statistical analysis. Null hypothesis and alternative…

Q: Some species undergo polyploidy, which is a multiplication of their chromosomes. That is, they…

A: Polyploidy is the condition of possessing more than two genomes. The diploid cell acquires…

Q: II. Given the following pedigree below, use Punnett squares for each of the following possibilities:…

A: 2.) a) In case of X-linked recessive: Genotype of I-1 (with normal phenotype) should be XAY, and…

Q: Define and compare osteomalacia to osteoporosis in relation to aetiology, pathophysiology and the…

A: Bones provide rigid structure to the body and protect many internal organs. The main composition of…

Q: 11 2. Copy the following table in your notebook. Complete the table by • identifying the…

A: Introduction :  Infection, presence, and proliferation of pathogenic (able to cause disease)…

Q: 10 ATP/Acetyl-CoA * 2 acetyl-CoA = 20 ATP 1 GTP/ Acetyl-CoA * 2 acetyl-CoA = 2 GTP 1,5 ATP/ FADH2…

A: The process of cellular respiration is a series of reactions that convert the energy from food…

Q: Why was the pea plant an excellent choice for Mendel’s  inquiry into heredity?

A: We all know that Gregor Johan Mendel is known as Father of Genetics.He was the first scientist who…

Q: During the process of double fertilization, the pollen tube grows into the ovule through an opening…

A: Sexual reproduction generally occurs in angiospermic plants.Double fertilization is an unique event…

Q: Briefly write on the characteristics and benefits of Healthcare Information System

A: A health information system is basically a system of different processes.This system mainly works to…

Q: What education is required to achieve botanists  and what goals are required to be a botanist

A: ANSWER) The botany is the field of biology which deals with the study of plants, it includes their…

Q: identify the vegetative propagule of eichormia.

A: Vegetative propagation is the process of asexual reproduction in plants. The process in which new…

Q: Dihybrid Crosses - Genotypes NOW YOU KNOW THE RULES - FOR EACH PHENOTYPE SHOWN IN THE PICTURES, WORK…

A: Introduction A gene exists in two alternative forms known as allele. When both the alleles are same,…

Q: What is a repetitive element in genomics?  What are the types of repetitive elements?  What is their…

A: The amount  of DNA present in a cell of a person is called as genome. DNA is made up of nucleotides…

Q: How do inversions act as crossover suppressors?

A: Introduction: An inversion is the chromosome rearrangement in which the   segment of a chromosome…

Q: Describe the role of the endocrine pancreas Describe the location and function of the pineal gland,…

A: The endocrine system is a complex network of glands and organs that secrete hormones into the…

Q: Which of the following cannot be seen by astronauts in the International Space Station with their…

A: Space research has many benefits for humanity. One of the main benefits is that it allows us to…

Q: p codon between gal and insulin parts? How do you separate the gal part from insulin insulin part B?…

A: Insulin biochemically, is a hormone and structurally it is composed of two chains that are cross…

Q: Which of the following statements is false? Macromolecules are able to take on characteristics or…

A: The body of a living organism is a self-replicated highly coordinated machine which is working…

Q: abbreviated name

A:

Q: Identify the glands of the endocrine system. Choose your answer from the box below.

A: Hormones are the chemical messengers of the body that travel through the bloodstream and help to…

Q: an you Describe in 1500 words,  the process of segregation of Bio-Medical wastes in a hospital?

A: Any garbage that contains dangerous substances that is created by healthcare institutions, such as…

Q: Muscular Development Training Enhance stabilization endurance while increasing prime mover strength.…

A: OPT means optimum performance training model. It has 5 phases. The phases (1 to 5)of OPT model are…

Q: Label this drawing of a plant cell

A: Plant cells are defined as the eukaryotic cells which differ from those of other eukaryotic species…

Q: Why don't protists (eg. sponges) need circulatory systems?   Question 12 options:   None of their…

A: Protists are a diverse group of eukaryotic organisms that are found in nearly every habitat on…

Q: epidemiological studies are applied to the control problems in communities? True False

A: Answer: Epidemiology : It is the study to find the causes of health issues and diseases developing…

Q: Where does absorption of nutrients happen in the vertebrate digestive system?

A: Digestion is a process in which the conversion of complex food substances into simpler absorbable…

Q: Draw a segment of DNA that has the 5’-TAGC-3’ sequence and its complementary strand

A: Please find the image below. The sequence with molecular details is given as follows.  The question…

Q: Using the trait in the previous question, identify the genotype and phenotype ratios from a cross…

A: Incomplete dominance dhffers with  complete dominance in a way that in incomplete dominance the…

Q: In which of the following situations would we expect atelectasis to develop?   A. pressure in…

A: Introduction The respiratory system is the biological system that consists of specific organs and…

Q: Answer the following: What is the synonyms or Latin names of Lemon tincture?

A: The most common citrus fruits include oranges, lemons, limes, and grapefruits. Lemons are known for…

Q: With a named example of each, explain the difference between a mutation and a polymorphism.

A: The term "Mutation" refers to a biological, sudden, and random change in the nucleic acid sequence…

Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…

A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.