Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding sequences. Label template strand: 5’-ACTGTGACCTTGACTGTCGATACGATG-3’ 3’-TGACACTGGAACTGACACGTATGCTAC-5’
Q: Name the 7 structures of the conductive zone. What is their role?
A: The ear is a complex organ that is responsible for converting sound waves into electrical signals…
Q: 2) A researcher crossed a heterozygous yellow seed plant (Yy) and a recessive green seed plant…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: For evolutionary biologist a) Identify and describe the career (everyday tasks, daily routines,…
A: In order to acquire the knowledge and abilities connected to evolutionary biology and other academic…
Q: 8. Which monosaccharides a. b. C. d. make up sucrose? glucose and fructose galactose and glucose two…
A: 1.We all know that carbohydrates are of different types based on the number of sugar molecules like…
Q: Label the diagram with the correct terms. XX A 2 A/ a 미 드 d
A: Introduction : Chromosomes are thread-like structures present in the nucleus. They are important…
Q: Define and compare osteomalacia to osteoporosis in relation to aetiology, pathophysiology and the…
A: Bones provide rigid structure to the body and protect many internal organs. The main composition of…
Q: 10. Many traits seen in organisms are wildly inefficient and prone to malfunction or injury. Why…
A: Genetics can help us understand the evolution of species: By studying the genetics of different…
Q: 18. A 1.5 % NaCl solution is hypertonic to red blood cells. What happens if red blood cells are…
A: A 1.5% NaCl solution is hypertonic to red blood cells. What happens if red blood cells are placed…
Q: Which of the following is an important model organism for studying development? a. E.coli O b. D.…
A: Model organisms: When the process of development is studied in detail the model organisms…
Q: The complete aerobic respiration of glucose yields far more energy stored in ATP than glycolysis…
A: Respiration is the process in which organic compounds are oxidized to release free energy inside the…
Q: 3 The experiment of Miller and Urey demonstrated that: That multicellular organisms form easily in…
A: Introduction The Miller-Urey experiment stimulated conditions thought at the time to present on…
Q: Describe the interactions of Agrobacterium tumefaciens with its host plant. Why is this plant…
A: Introduction: The bacterial pathogen Agrobacterium tumefaciens is a vital component in plant genetic…
Q: Answer the following: Synonyms/Latin Nmaes of Acacia Mucilage Therapeutic Classification of Acacia…
A: 1) The Synonyms/Latin Names of Acacia Mucilage are- Mucilago Acaciae, Gum Arabic, Goma Arabiga,…
Q: Your client presents with knee pain, worse in the morning, “it’s very stiff until I warm it up” he…
A: Introduction:- Connective tissue helps in binding of body organs together and provides protection…
Q: This scientist provided evidence that spontaneous generation does not occur by showing that the…
A: In 1668, the theory of spontaneous generation became widely accepted. It implied that life evolved…
Q: an you Describe in 1500 words, the process of segregation of Bio-Medical wastes in a hospital?
A: Any garbage that contains dangerous substances that is created by healthcare institutions, such as…
Q: Describe the differences in gene expression that can occur in cells that are attached to a biofilm…
A: The behavior and survival of microorganisms are greatly affected by their environment. One of the…
Q: Direction: Read and analyze the following laboratory experiment and answer the following question.…
A: Indipendent variable :- It is the cause, we study and the value of independent variable is…
Q: determine all the types of mutations and mention if they are harmful or not and why?
A: There can be errors in DNA which can lead to protein dysfunction or misfolding. These errors are…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: The research contributes to a better knowledge of illnesses and other health issues, such as their…
Q: statement(s) describe the function of the protein encoded by KMT2D ? Transcription factor…
A: statements describe the function of the protein encoded by KMT2D are---- ## The protein encoded by…
Q: Part III-PGD? Suzanne and David decided to have children. They wanted to ensure that their children…
A: NOTE: according to the answering guidelines, I am going to answer only first question. Please post…
Q: Problem. In a practical session, students studied a stained blood smear of a mouse with bacteria…
A: Phagocytosis is a process of ingestion of nutrients or foreign substances inside the specialised…
Q: Explain what epigenetic theory is.
A: Greek for "epi" means "on or above," thus "epigenetic" refers to elements other than the genetic…
Q: typical prokaryotic cell has about 3,000 genes in its DNA, while a human cell has almost 21,000…
A: Similar genes present in two different organisms is suggestive of some common features that occur in…
Q: Which of the following is true? Question 10 options: a) A person's phenotype is a trait that…
A: Any observable trait in a person such as height, eye colour or blood type is referred to as…
Q: Define terebinthinate
A: introduction: The word turpentine is derived from the Greek word terebinthine, which is also the…
Q: What does tissue culture infective dose 50 mean? Write briefly. Calculate the percentage cytopathic…
A: Viruses are submicroscopic organisms that live and replicate only in the host cells like bacterial,…
Q: Food going through the human digestive system only moves in one direction in some animals however…
A: The evolution of various kind of digestive system of animals helps them to digest their different…
Q: There is a spherical neuronal soma with a radius of 35 µm and a resting membrane potential of -60 mV…
A: Neuronal soma- It is the main part of the neuron in which the dendrites come out as branches.…
Q: reaction where glucose is broken down into carbon dioxide and water.
A: The efficiency of breaking down glucose is important because it is the main source of energy for the…
Q: homeostasis definition in your own words? thanks
A: Homeostasis regulates the internal environment of an organism and maintains a stable or constant…
Q: describe the mechanism of how tissue damage leads to pain and how NSAIDs therefore provide…
A: Pain is a complex sensation that can be caused by various factors, including tissue damage. When…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: Which regulating body system operates at the fastest rate?
A: All organs and systems work together because they are closely regulated by nervous and endocrine…
Q: Plasmodium use digestive vacuoles (DV) to digest hemoglobin and heme from red blood cells into fuel…
A: The researchers found that VF-6-2 bound to PfCRT with the same affinity of chloroquine and it was…
Q: hybrid has two different genes for a given trait a. True b. Fasle If B indicates tallness then an…
A: Introduction : A single cell divides twice to form four cells during the meiosis process. The…
Q: What might happen if a fish from one of the Ontario Great Lakes was suddenly placed in ocean water?…
A:
Q: What is a repetitive element in genomics? What are the types of repetitive elements? What is their…
A: The amount of DNA present in a cell of a person is called as genome. DNA is made up of nucleotides…
Q: All land plants undergo the process of alternation of generations. During this process, individuals…
A: A plentiful amount of water was necessary for the first terrestrial plants to survive. Land plants…
Q: Why is step 2 correct, is it because this is a repressible operon?
A: Operon is a cluster of genes which contains operator, promoter and structural genes. It is a kind of…
Q: In some cats, the length of the tail shows incomplete dominance. The tail can be long (L), short…
A: Incomplete dominance also called as partial or incomplete dominance, a phenomenon in which two true…
Q: Discuss the sequential steps of innate immune system activation in response to SARS-COV-2 infection…
A: We all know that Covid-19 is a deadly virus which already created a pandemic on our world.It first…
Q: Are healthcare policies effective over time?
A: Healthcare policies are rules and regulations that are made in order to achieve certain healthcare…
Q: b) Consider the scenario where during intense exercise, a person's body produces high levels of…
A: Muscle cells of the body depend on ATPase to perform their role in the body during exercise, as…
Q: ‘T cells and phagocytes are more crucial to human survival than complement and antibodies.’ Evaluate…
A: ANSWER) In order to answer this question we need to understand what are T cells and and Antibodies.…
Q: Suppose a 10-year old patient has come to your office with a very rare disease. One so rare that…
A: Rare diseases - Diseases which affects very small percentage of population. Gene sequencing - It is…
Q: Explain why seasonal stratification of temperature and oxygen takes place in deep ponds and lakes.
A: The propensity of lakes to generate separate and distinct thermal layers during warm weather is…
Q: You have been asked to engineer a protein (which is not an immunoglobulin) that is capable of…
A: Protein engineering is the process of deliberately modifying the structure and/or function of…
Q: MODEL 1: 1. His 119 6. His 119 CH O-P-O- 01 HCHO HCH Substrate O-P-O OH +H₂N OOH CH H₂N. His 12 $…
A: Enzymes are the proteins synthesized in the cell by the process of translation from mRNA. The…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
- Please draw the pre-mRNA that would be produced from this gene.Gray
nucleotides indicate noncoding sequences. Label template strand:
5’-ACTGTGACCTTGACTGTCGATACGATG-3’
3’-TGACACTGGAACTGACACGTATGCTAC-5’
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) 5'TATTATAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3'-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter (i) (ii) TSS (iii) Terminator Figure 2 Which DNA strand (the top or the bottom) is used by polymerase as a DNA template? List the mechanistic steps that can trigger the initiation of transcription by the Sigma Factor. What are the amino acids translated from the resulting mRNA? Indicate the amino (NH₂*) and carboxyl (COO) termini of the polypeptide chain.The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThe bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.
- Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to 330. Transcription starts at the Transcription Start Site (TSS) that is the base located at position 57. -55 5' AATAAСTTGAGATTTTGATTGACАТССТТСТСАCAGAGCCTATAATACCТАТТТС 3' 3'TТАТTGAACTСТААААСТААСТGTAGCAACAGTGTCТСGGATATTATGGATAAAG 5' 56- 5' ТACGTATAGAСАСТСAGAGGAAAGACAGAGAGAGAGTTAGCATTGTACTАТСТСТ 3' 3' АTGCATATСТсTGAGTCTCCTTтстстстстстсТСААТСGTAACATGATAGAGA 5' 65- -105 --110 -140- 5' СТTTTAGATATATCTCТАТСТСТСТСАСТССАТСТТТСТCGTGTTAACACAAСА 3' 3' GAAAATCTATАTAGAGATAGAGAGAAGTGAGGTAGAAAGAGCACAAТТСTСТTGT 5' 111- -120- -130- -150- -160----165 166- --175- --185- -195 -205- -215-----220 ------- 5' GTCACAGACTCACAGATCTTTGTCGGTGATCGGAGATGGAGTTCCGGGAGAAGCT 3' 3' CAGTGTCTGAGTGTCТAGAAACAGCCACTАGССТСТАССТСААGGCCCTСТТCGA 5' 221- -230- 240 -250 -260 -270-----275 5' TTATAAGTTCAAGTTGCAATAGGTGTTTGCCTTTGTTTTATCTCTCCTCACCGTA 3' 3'ААТАТТСААGTTCAACGTTATCCАCAAACGGAAACAAAАТAGAGAGGAGTGGCAT 5' 276- -285- -295- -305 -315…For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.
- The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________The double stranded DNA sequence shown contains the promoter for the transcription of a bacterial gene. GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT Draw a box around each of the promoter elements and identify each. Identify which strand will be used as the template strand by putting a vertical line between the -1/+1 start site nucleotides and underlining in the direction of transcription on the template strand as the example below indicates. ATCGG\GAATCGC TAGCCCTTAGCG Give the sequence of the RNA created