To which part of DNA do the eukaryotic transcription factors bind? O a. promoter regions O b. enhancers O C. AUG (the first codon) O d. operator Oe. DNA introns
Q: QUESTION 37 If glycogen synthase kinase-3 is active (check all that apply): O glycogen will not be…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: General functions of the cytoskeleton maintains the cell shape movement of proteins and lipids…
A: The cytoskeleton is a structural framework made up of protein filaments: actin filaments,…
Q: 1 lactose is the digestive enzyme that breaks the dissaxhrode lactose into glucose and…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: Convert 475 cal to joules
A: Calories, joules are used to determine the amount of energy present in the food . The energy given…
Q: Please draw 2 diastereomer of the following molecule
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Isomers are…
Q: The drug below is used in the treatment of: O Rheumatoid arthritis. O Gram(+) bacterial infections.…
A: Heterocyclic ring is a ring structure made up of different atoms. Given to us a heterocyclic…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: Beer’s Law: In serum cholesterol analysis, if the grad. cylinder that measured the acetic acid…
A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…
Q: Match the protein subunit with the correct functional component of the yeast ATP synthase complex in…
A: ATP synthase has two parts-Fo and F1. The Fo is bound to inner mitochondrial membrane whereas the F1…
Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…
Q: 3- True or False: A given reaction, such as the hydrolysis of ATP can do a set amount of…
A: Adenosine triphosphate, or ATP, is a small molecule. It can be viewed as the primary energy currency…
Q: A new oxygen transport protein that exhibits cooperative binding has been isolated and is being…
A: The Hill equation for O2 binding to a protein can be used to solve this problem. The equation is…
Q: Draw the structure of the a-methyl-pyranoside form of mannose following the reaction of the sugar…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: The following is a(n) [Select] [Select] V [Select] disaccharide with a(n) glycosidic bond.
A: Disaccharides are sugars which are formed as a glycosidic bond is formed between 2 monosaccharides.…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: Introduction: An antagonist is a substance that does not cause any biological response itself but…
Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: What are the biochemical cycles?
A: Biochemistry is the way of understanding of different chemical reactions that occur within the…
Q: The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Identify examples of a carbohydrate that is: unbranched, reducing monosaccharide
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Exam pe reaction That require energy Catabolic Allosteric site ADP+POATP Entropy increases 2nd law…
A: Enzymes are catalysts that speed up biochemical reaction. These are workable under particular…
Q: What explains the observation that FADH2 oxidation yields one less ATP than NADH oxidation by the…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…
A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: A scientist made mistakes during DNA extraction. On his first attempt, he blended the sample too…
A: Blending is done when DNA is to be extracted from multicellular samples like tissues of animals and…
Q: . A. Many bacterial fatty acids contain branches and even rings. What effect would you expect these…
A: Some bacteria are able to survive under harsh settings that are hostile to nearly all other forms of…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: Problem. The student conducted a chemical experiment to prove the reducing properties of maltose…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: The term that refers to the light-dependent process in plants in which O₂ is consumed and CO₂ is…
A: Plants need energy to perform the functions that keep them alive, just like all other living…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: if we are able to recreate or stimulate telomerase, could humans potentially live forever?”
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 3. Researchers purified a new enzyme and during an initial characterization determined the Vmax to…
A: Enzyme inhibition is when an inhibitor bind to the enzyme at the active site or another site, which…
Q: Can human digest this trisaccharide?What bond is it between sugar B and sugar C?(be specific)
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Which monosaccharide(s) seen below is(are) an epimer of the structure on the left? H- НО Н- H CHO О…
A: Two isomers that are correlated to one another by reflection are called optical isomers or…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…
A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: Consider the two half-reactions below and their standard reduction potentials. NAD+ + H+ + 2e → NADH…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Give a summary of your results for Food Sample 2 (Unknown). What kind of food item do you think this…
A: Benedict's test determines the presence or absence of reducing sugar in a solution. The iodine test…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: What shuttle mechanism transfers the electrons from cytosolic NADH into the mitochondria with the…
A: Mitochondrial inner membrane is impermeable to NADH. Hence, for transfer of NADH, it is first…
Q: How does ATP regulate the activity of PFK-1? ☐☐ ATP binds to PFK-1 at the catalytic site as a…
A: Glycolysis is a process in which glucose is oxidized & is converted to pyruvate and in that…
Q: The enzyme phosphoglucomutase catalyzes the conversion of glucose 1-phosphate to glucose…
A: Phosphoglucomutase is the enzyme that catalyze the interconversion between glucose 1-phosphate (G1P)…
Q: Do carbohydrates and sugars cause weight gain? Explain your answer.
A: Your body receives 4 calories from every gram of carbohydrates. You will gain weight if you consume…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Kinesin movement is dependent on GTP hydrolysis. True False
A: Kinesin is a motor protein that is essential for the cellular functions like mitosis, transport of…
Q: The Z-scheme of photosynthesis produces approximately a 3:2 ratio of ATP:NADPH. How does a C4 plant…
A: In chloroplasts, photosynthesis starts when an electron from PSII's (Photosystem II) P680 reaches a…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
![To which part of DNA do the eukaryotic
transcription factors bind?
a. promoter regions
enhancers
O b.
O C.
AUG (the first codon)
O d. operator
Oe. DNA introns](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fd7bf774f-fe51-4121-93c6-6dec45c8cd41%2F6a0115d9-cd5d-4170-a86f-f578e468d31e%2Fhhth17_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNAWhy might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1A
- Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made up of only introns c. it is constructed from mRNA that is reverse transcribed d.Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene surface B. A transcription factor bonds to a promoter site C. An mRNA molecule is produced D. The transcript leaves the nucleus E. An MRNA polymerase attaches to the template strand Which if the following shows the correct sequence? ACEDB ЕВАCD ОВАСЕ D EACAD О САВЕD О АВСЕD В АEDC ВЕАСD EABCDWhich is true about eukaryotic cDNA?Choose all that apply. a. it is constructed from mRNA that is reverse transcribed b. it is made up of only introns c. it is single stranded d. one gene may generate more than one cDNA
- What is the name of the process that adds a modified guanosine nucleotide to the 5’ phosphates of pre-mRNAs in eukaryotes? a. splicing b. polyadenylation c. capping d. nuclear export e. photophosphorylationA prokaryotic gene was transcribed then translated. During the process, antibiotics X was added, and the products of translation were only f-met. What steps in translation was inhibited by antibiotic X? A. Transpeptidation or the formation of peptide bonds B. Binding of amino-acyl t-RNA to the 30S subunit of the ribosome C. Formation of the functional ribosome D. Translocation or the movement of empty t-RNA to the E site. E. Hydrolysis of GTP8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has been transcribed from DNA B. Converts a protein sequence to mRNA
- 1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino acids b. A protein/RNA complex that synthesizes protein c. A ribozyme that uses RNA as an enzyme to directly ligate free amino acids to tRNAs d. A multi-subunit protein complex that charges tRNA with amino acids 1.2 In RNA processing? A. Exons are added to the ends of mRNA for protection B. Intron sequences are removed before the mRNA is translated C. The RNA transcript that leaves the nucleus may be much longer than the original primary transcript D. All RNA transcripts will be processed and leave the nucleus.Which of the following molecules is used to transfer the genetic code from the nucleus to the cytoplasm, during translation? 44. A. transfer RNA B. messenger RNA C. ribosomal glycoprotein D. phospholipids the itrarhar br vhaWhat site on the ribosome is the place where a tRNA molecule leaves the ribosome after attaching its amino acid to the growing chain of amino acids? a. E site b. P site c. A site d. the small ribosomal subunit Please respond as soon as possible
![Concepts of Biology](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)
![Concepts of Biology](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)