The function of the 5’-> 3’ exonuclease activity is found in which of the following: Group of answer choices 1 All of the above 2 DNA Polymerase II 3 DNA Polymerase III 4 DNA Polymerase I
Q: Below is a sample of a segment of DNA…(copy from left to right) 3’…
A: Mutation It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…
Q: Your company has decided to develop a PCR test that will be used to determine Huntington's disease.…
A: The polymerase chain reaction (PCR), is one of the most useful molecular biology techniques used to…
Q: Deletions of entire genes from the chromosome can be repaired by: Group of answer choices…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: At a specific area of this chromosome, the sequence of nucleotides below is present where the chain…
A: The region of DNA known as the replication fork is where the replication process itself is now…
Q: Which of the following is NOT true regarding E. coli replication on the lagging strand? initially…
A: In molecular biology, DNA replication is the process of making two identical DNA molecules from one…
Q: The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome…
A: In prokaryotes, the DNA replication is carried out with the help of various enzymes, like, DNA…
Q: Why must the lagging strand of DNA be replicated in short pieces a. Because of limited space b. To…
A: The replication of the DNA takes place in a semiconservative pattern in which the DNA duplex unwinds…
Q: Polymerase chain reaction is— a reaction involving a chain of different types of polymerases…
A: PCR is a technique to make many copies of DNA in vitro. It relies on thermostable Taq polymerase and…
Q: In ONE sentence define the function of the following 1. SSBS = The SSBS are single 2. Beta subunit…
A: These are all the enzymes used in replication of DNA Replication of DNA is a very important process…
Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA…
A: 1. The ligase enzyme joins two nucleotide molecules together during transcription. The answer is…
Q: DNA polymerase IIl sometimes makes a mistake during replication and builds the wrong nucleotide into…
A: A mutation is a phenomenon in which the Deoxyribonucleic Acid (DNA) segments are inserted into or…
Q: 110.Which of the following joins Okazaki fragments by forming the last phosphodiester/ester bond…
A: Okazaki fragments are short stretches of DNA nucleotides (about 150–200 base pairs in eukaryotes)…
Q: Human Fbh1 helicase is important in the process of DNA replication. When a muta occurs during the…
A: Introduction : 1) DNA replication is the process by which the genetic material is copied within the…
Q: In denatured DNA, DNA double helix is disrupted, which causes the exposure of the bases and thus…
A: The correct option is the C option: In denatured DNA, DNA double helix is disrupted, which causes…
Q: The DNA sequence below is used by the primase to synthesize a primer. What is the sequence of the…
A: The primer of this sequence will be complementary to it. The complementary bases are as follows: A…
Q: DNA polymerase I has both a 5' to 3' exonuclease activity and a 3' to 5' exonuclease activity.…
A: DNA polymerase are enzymes needed for the replication of DNA
Q: Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA…
A: Point mutation : It occurs as result of replacement of one nucleotide by other. point mutation bring…
Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…
A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…
Q: How often, on average, will the endonuclease AluI, which cleaves the sequence 5’ AGCT 3’, cut normal…
A: Enzyme restriction, also referred to as endonuclease restriction, is a protein formed by bacteria…
Q: Why is it important that the alcohol used in the DNA extraction is kept cold?
A: The ice cold alcohol, helps to isolate the DNA from a solution.
Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…
A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…
Q: How do the enzymes involved in the mismatch repair process determine which of the two bases in the…
A: DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA…
Q: DNA polymerase is responsible for everything listed below except Select one: a. adding nucleotides…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: In the following drawing, the top strand is the template DNA, and the bottom strand shows the…
A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following…
A: DNA universally has 4 N-bases: Adenine, Thymine, Guanine and Cytosine If the given strand sequence…
Q: What is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b.…
A: DNA is the genetic material of an organism. DNA replication is a process in which two DNA molecules…
Q: A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following…
A: Multiple copies of DNA copies can be achieved with the polymerase chain reaction in large amounts of…
Q: Which of the following best explains the leading daughter DNA strand? The leading strand is…
A:
Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…
A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…
Q: Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: You prepare a reaction mix containing (i) DNA polymerase II, (ii) DATP, dCTP, DGTP, Mg2+, and…
A: DNA replication is considered a process, during which new strands are synthesized.
Q: In eukaryotes, primers generated during DNA replication are made of _____________ and are removed by…
A: Given here are some of the statements regarding DNA replication:- following is the correct option…
Q: What is a true statement about the leading and lagging strands during DNA synthesis? The leading…
A: Ans : Correct statement for the above question is - The lagging strand is created due to DNA…
Q: his is responsible for breaking hydrogen bonds between complementary nucleotides of a DNA duplex…
A: Helicase is the enzyme responsible for breaking hydrogen bonds between complimentary nucleotides of…
Q: Adenylate cydase, which synthesizes cyclic AMP from ATP, requires two metal ions, and the enzyme has…
A: Nucleophile is a chemical species with more electrons. This chemical species donates its electron…
Q: Which of the following is true about the denaturation of double-helical DNA? A. Denaturation…
A: The hydrogen bonds between DNA strands weaken and eventually break when the temperature of a DNA…
Q: 1.1 What components must be available for DNA polymerase III to proceed with DNA synthesis during…
A: DNA replication is the process in which DNA itself act as template for the formation of DNA strand…
Q: If you had a mixture of single-stranded DNA fragments, all 4 deoxyribonucleoside triphosphates, and…
A: DNA replication is the process of producing complementary DNA molecules from the ds DNA molecule.
Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank)
A: This question is based on the Dna replication.
Q: How many unique primers are required to amplify a single DNA target region? a) 1 b) 2 c) 4 d)…
A: Targeted sequencing is a fast and low-cost method to detect known and novel variants in specific…
Q: What is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…
Q: How does the enzyme telomerase meet the challenge of replicating the ends of linear chromosomes?…
A: A telomere is the end of a chromosome which is made of repetitive sequence of non coding DNA which…
Q: Why is DNA not soluble in ethanol whereas other components cells are soluble. What is the rationale…
A: DNA isolation is a method through which the cell is lysed and DNA is isolated from the same using…
Q: ollowing base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true…
A: DNA polymerase is the enzyme used for the replication of DNA. The polymerase uses the template DNA…
Q: After four cycles of PCR, which type of PCR product predominates? Explain why.
A: Polymerase chain reaction (PCR) is a method widely used for rapidly producing millions of copies of…
Q: In the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one…
A: In 1958, Matthew Meselson and Franklin Stahl performed an experiment which supported the DNA…
Q: Which of the following statements is/are TRUE for both replication and transcription? Polymerase…
A: DNA replication is the biological process of producing two identical copies of DNA from a double…
The function of the 5’-> 3’ exonuclease activity is found in which of the following:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Match the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 NextWhich of the following has 5’ to 3’ exonuclease activity? DNA polymerase I DNA polymerase III DNA polymerase I and III HelicaseThe function of the 3'-> 5' exonuclease activity is found in which of the following: DNA Polymerase III DNA Polymerase I DNA Polymerase II All of the above
- The 5'-3' exonuclease activity involves all the following EXCEPT: o Both ribonucleotides and deoxyribonucleotides can be removed. O DNA repair can also be undertaken by this activity. o Groups of altered nucleotides can also be removed. o Removal of one nucleotide at a time in the properly base paired DNA. o Activity is possessed by both DNA polymerase I and IIIWhat does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0Which of the following enzymes has 5’ to 3’ exonuclease activity? DNA ligase DNA polymerase I Telomerase Primase DNA polymerase III
- For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?DNA polymerase I has 5'-3' polymerase activity, 5'-3' exonuclease activity, and 3'-5' exonuclease activity necessary for DNA replication. Mutations in the gene that encodes DNA polymerase I may cause the enzyme to lose these activities. Match the consequence of a loss-of-function mutation in DNA polymerase I to the corresponding lost activity. Lost 5'-3' polymerase activity no RNA primer removal during DNA replication no double helix denaturation Lost 5'-3' exonuclease activity Answer Bank decreased polymerase fidelity Lost 3'-5' exonuclease activity no DNA synthesis to fill gaps caused by removing RNA primers unstable strand separation within the replication bubble
- Please match the following enzymes with their correct functions. Primase, Gyrase, Ligase, Polymerase, Helicase, Topoisomerase 1.Unwinds DNA at the replication fork. 2.Makes and reseal breaks in the double-helical DNA to release the torque that builds up as a result of unwinding at the replication fork. 3.Synthesizes a short RNA to provide a 3’ -OH group for the attachment of DNA nucleotides. 4.Removed RNA primers and replace them with DNA. 5.Joins Okazaki fragments.Describe precisely the catalytic activity of DNA polymerase I that removes RNA primers. 3' to 5' exonuclease 5' to 3' exonuclease 5' to 3' endonuclease O 3' to 5' endonucleaseDuring eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a 3'-OH group to which DNA nucleotides are be added by DNA polymerase. DNA gyrase (topoisomerase) DNA helicase DNA ligase primase
