What is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b. the DNA strands are anti-parallel c. one strand runs 3’ to 5’ d. one strand runs 5’ to 3’ e. both strands have identical bases

What is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b. the DNA strands are anti-parallel c. one strand runs 3’ to 5’ d. one strand runs 5’ to 3’ e. both strands have identical bases

Name: What is true of this figure? (can be multiple answers)a. the replicati
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is true of this figure? (can be multiple answers)a. the replication fork is asymmetricalb. the DNA strands are anti-parallelc. one strand runs 3’ to 5’d. one strand runs 5’ to 3’e. both strands have identical bases 5'3'parentalDNA helix3'5'newly

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 12RQ: Which of the following components is not involved during the formation of the replication fork?...

See similar textbooks

Similar questions

5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two strands will have a continuous replication? 7. Which is the lagging strand? 8. Along which strand will Okazaki fragments appear? 9. How are Okazaki fragments joined together? 10. Where should the 3' end of the lagging strand be located? On the right or left side? in
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
Matching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication fork
3 E D C The arrow in the diagram below indicates the direction of movement of the replication fork. 5' S R F Q Search Which letter indicates a strand that is synthesized discontinuously? OA Ов ос V A F5 T C G B F6 T 6 Replication B LDL Y F7 H & 7 WALLS U N F8 * 00 99+ 8 J₁ F9 kirimmi MO 35 Alt מם E K 2 F10 L P < F12 10:05 AM 4/8/2023 Ctrl 10 B
A region of DNA has six copies of a trinucleotide repeat. During one round of replication, the template strand slips as shown in the diagram. How many repeats will the DNA have if the newly synthesized strand is used as a template in the next round of replication? 1 5'-CAG 3'-GTC GTC 4 2 GTCH 3 2 CAG CAG GTC 3 GTC 5 4 CAG-3' GTC -5' 6 Next round of DNA replication
Draw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends 2. All 5’-phosphate ends 3. leading strand (s) 4. lagging strand (s) 5. Okazaki fragments (draw 3) ❏ RNA primer(s) 6. direction of replication ❏ replisome(s) 7. origin (s) 8. terminus (i)
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
1 2 3 4 5 6 7 8 9 The gaps between the DNA fragments are sealed by DNA ligase Elongation of both the lagging and the leading strand Topoisomerase binds at the region ahead of the replication fork Primase synthesizes RNA primers RNA primers are removed and gaps are filled by DNA pol I DNA unwinds at the origin of replication DNA polymerase III starts adding nucleotides Helicase opens up the DNA-forming replication forks Single-strand binding proteins coat the DNA Arrange the processes involved in DNA replication
Pues (two-ringed) 9. (a) Label each nitrogenous base in the double strand of DNA in Figure 4. NEL P-C.₂. H- (a) -CH₂-P-C₂ 5' 0 PCH₂ (b) -Н -CH₂-P-C₂ 5' 0 PCH₂ CH₂-P-C₂ H 0 I' P 5' 0 (d) 3' CH₂ H PCH₂ Figure 4 (b) Figure 4 above shows a phosphodiester bond. Explain what this is. 1.5 Pr
Origin of replication Leading strand Lagging strand Leading strand Lagging strand Overall directions of replication Leading strand -DNA pol II Primer Primase Parental DNA DNA pol III Lagging strand DNA pol I DNA ligase 3' What are the components and their function of DNA replication in the leading and lagging strand?
Which of (a)-(d) is complementary to the DNA segment 5'-ATGAGCCAT-3'? * 5-ТАСТССGTА-3' 5-ТАСТСGGTА-3' 5'-TCATCGGTA-3' 5'-TACTGCGTA-3'
Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA Replication fork A [ [ Choose ] [ [ Choose ] [ [ Choose ] D [ [ Choose ] E [ [ Choose ] > > > > B.