The 5’-ACTGCA DNA probe will hybridize with (stick to) which of the following DNA strands? a. 5’-TGACGT b. 3’-UGACGU c. 5’-GGCAAU d. 3’-TGACGT e. 5’-CCGUUA
Q: Blood plasma flows with a rate of 0.4 cm³/s through a tube with a diameter d = 0.18 cm and length I…
A: Solution for Maintaining Flow Rate and Pressure at ExitWe can solve this problem by considering two…
Q: Which of the following is TRUE about the fossilization proccess: A. a stable enviornment is…
A: The question is asking us to identify the correct statement(s) about the fossilization process.…
Q: How does the r-strategy predict the reproductive rates of a population of organisms?…
A: The objective of the question is to understand how the r-strategy, a concept in biology, predicts…
Q: In tomato plants, three genes are linked on the same chromosome. Tall is dominant to short, skin…
A: A genetic map is a representation of the linear order of genes and genetic markers on a chromosome.…
Q: Is the following case study an r-strategists or a K-strategists? Andean condors reach sexual…
A: The objective of the question is to determine whether the Andean condors are r-strategists or…
Q: #7
A: Evidence for Homo species, such as Neanderthals and Denisovans, as well as anatomical modern humans,…
Q: Why is it important to study human cardiovascular function?
A: The objective is to study human cardiovascular function.
Q: Which season of the Babylonian year corresponds to the darkest night (midnight to dawn)? Spring,…
A: The objective of the question is to identify the season of the Babylonian year that corresponds to…
Q: What do you understand from negative stain, simple stain, and acid-fast stain?
A: Negative stains, simple stains, and acid-fast stains are all techniques used in microbiology to…
Q: Under which of the conditions would the magnetic field clearly dominate the behavior of the…
A: Answer option B.Explanation:Step 1:Step 2:Step 3:Step 4:
Q: Ammonia is oxidised to nitrate with the help of which bacteria? 1.Nitrobacter 2.Nitococcus…
A: Here the given information is thatAmmonia is the mineral which is oxidised to nitrate,we need to…
Q: Kingdom Plantae is characterized by which of the following features? glycerol-1-phosphate lipids,…
A: The objective of the question is to identify the correct set of features that characterize the…
Q: 1. Describe the biological roles of the viral capsids in the virus life cycle.
A: Although the life cycle of viruses varies widely depending on the species and category, all viruses…
Q: I. A cross in corn involving 3 seed characters will be studied: smooth endosperm (+) shrunken…
A: Based on the provided data, we can determine the genotype of each progeny:Smooth, colored, starchy:…
Q: People once believed all microbial diseases would be controlled by the twenty-first century. Name at…
A: An infectious disease is a disease that is caused by the invasion of agents whose activities harm…
Q: Class garticipation Q#3 What is the relationship between the two structures of…
A: The objective of the question is to understand the relationship between the two structures of…
Q: Linked Genes While working with a type of beetle that is normally smooth and large, you discover…
A: They tell us that crosses with the true breeding parents produce both large and smooth F1 flies.…
Q: Separately, draw a table using arrows to depict the appropriate magnitude and direction of the…
A: Ligand-gated channels are integral membrane proteins that respond to the binding of specific…
Q: = Probable pattern of inheritance: 5 □O White Yellow O Green
A: Mendelian genetics principles are used here, specifically focusing on autosomal dominant or…
Q: Transport. Provided below is an abstracted equation describing an active cell membrane transport…
A: Disclaimer: According to our authoring guidelines, we can only provide the solution to your first…
Q: Viral DNA synthesis cannot take place in a resting cell. How is this problem solved? Group of answer…
A: DNA synthesis is the process by which a cell duplicates its DNA to produce two identical copies of…
Q: In what ways are dark field microscopy and negative staining alike?
A: Microscopy is a fundamental strategy in biological and materials science that permits analysts to…
Q: a. in a population with allele frequencies that are p=0.44 and q=0.54. How many homozygous recessive…
A: Ans. a To determine the expected number of homozygous recessive individuals in a population, we can…
Q: Based on your diagnosis for Ema, name and briefly summarise the rationale for 10 different medical…
A: Given Ema's symptoms and the results of her tests, she's likely diagnosed with sickle cell disease…
Q: In jabuticaba tree plant, Plinia cauliflora, the AA, Aa plants round fruit and aa oval fruit, the…
A: Complete dominance occurs when the phenotype of the heterozygote (Aa) is indistinguishable from the…
Q: In the Paraguayan Easter Atlantic Forest, a mating between a homozygous black yaguarundi and a…
A: Jaguarundi Coat Color Genetics:A) Genetic Interaction:The observed inheritance pattern suggests a…
Q: True or False: 1- The process of cellular respiration occurs in the mitochondria and involves the…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: What is the probability that 3 of the children are polydactyl
A: Polydactyly is an autosomal dominant trait, where polydactyly (P) is dominant to normal…
Q: The ethidium bromide added to the agarose gels intercalates within the base pairs of the DNA double…
A: The visualization of DNA refers to the ability to observe and detect the presence of DNA molecules…
Q: Alpha Beta chain chain CHO CHO Disulfide bridge CHO CHO What kind of receptor is show in the figure?…
A: It is an T cell receptor Explanation:The T cell receptor (TCR) is a crucial component of the immune…
Q: You have collected data on the observed genotype frequencies of the next generation. They are: 60%…
A: In order to check whether the population is evolving or not it should follow the Hardy Weinberg's…
Q: What is the projected population number at N5 (after 5 generations)? Enter the number below as a…
A: Population size refers to the total number of individuals in a particular area. The larger and…
Q: Class garticipation Q#3 What is the relationship between the two structures of…
A: The objective of the question is to understand the relationship between the two structures of…
Q: Epidemiologist rely on a set of standard study designs to understand the distribution of 'diseases'…
A: The objective of this question is to design a hypothetical study to investigate a potential…
Q: SCIEN
A: Identify cell type Prokaryote or EukaryoteThe organism is a eukaryote and the structure the arrow is…
Q: Which of the following concerning progeria are false? Choose all that apply.
A: 1. Regularly, Zmpste24 slices pre-lamin to eliminate 50 amino acids.Zmpste24 is a catalyst engaged…
Q: You take a mouse that has green eyes and a short tail and cross it to one that has brown eyes and a…
A: Meiosis is also known as reductional division. It is a special type of cell division which occurs in…
Q: An important aspect of phosphor-peptide recognition by SH2 domains is an invariant aspartate side…
A: The center of the inquiry is on the strategies through which proteins are connected with ligands and…
Q: Is the following case study an r-strategist or an K-strategist? Elephants live for about seventy…
A: The objective of the question is to determine whether the given case study of elephants is an…
Q: The great apes made their first appearance in the fossil record between 23 and 2.6 MYA, which:…
A: The question is asking us to identify which geological period corresponds to the time frame of 23 to…
Q: In the species Chinchilla chinchilla, Neotropical crepuscular rodent of the parvorder Caviomorpha, a…
A: The given scenario describes a genetic phenomenon known as incomplete dominance.In incomplete…
Q: Largemouth bass is one of the most popular sport fish in Texas, and state law dictates that to…
A: Multiple genes contribute to the length of largemouth bass, showing a polygenic inheritance…
Q: In addition to pap smear screening, discuss other actions to reduce the risk of cervical cancer.
A: The objective of the question is to discuss the various preventive measures, apart from Pap smear…
Q: 25- Which organelle is responsible for maintaining cell shape, providing mechanical support, and…
A: The organelle is the sub-structure of the cell that has a key role in the proper functioning of the…
Q: Each graph below depicts reaction norms for three different genotypes reared in different…
A: The question asks you to determine in which cases the Environmental Variance(VE) is greater than the…
Q: A four-chambered heart, with a complete septum between the left ventricle and the right ventricle,…
A: The question is asking which of the listed vertebrate groups does not have a four-chambered heart,…
Q: Negative feedbacks. Negative feedbacks are pervasive in biological systems. Fill in the "type" of…
A: Negative feedback mechanisms play a significant part in keeping up homeostasis and controlling…
Q: A scientist transfers 0.1 mL phage stock to a tube containing 9.9 mL tryptic soy broth. She then…
A: The total fold of dilution represents how much the original concentration has been reduced due to…
Q: Write a essay in the form of an introduction to the research area of the topic 'Neuroscience of…
A: The objective of this question is to provide an introduction to the research area of 'Neuroscience…
Q: What would have been the effect on the formula weight you calculated for your unknown If the…
A: The question is asking about the potential impact on the calculated formula weight of an unknown…
The 5’-ACTGCA DNA probe will hybridize with (stick to) which of the following DNA strands?
a. 5’-TGACGT
b. 3’-UGACGU
c. 5’-GGCAAU
d. 3’-TGACGT
e. 5’-CCGUUA
Step by step
Solved in 3 steps
- What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC-5 O 3- GCCTACGGGCATATG -5 O 5-GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG-3 O3-CGGATGCCCGTATAC -5What is the correct order for the steps of transformation given inthe following list?1. Recombination with the bacterial chromosome2. Binding of a large DNA fragment to the surface of a bacterialcell3. Cutting a large DNA fragment into smaller pieces4. Uptake of DNA into the cytoplasm5. Degradation of one of the DNA strandsa. 1, 2, 3, 4, 5b. 2, 3, 5, 4, 1c. 2, 3, 4, 5, 1d. 2, 5, 4, 3, 11 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
- The following data is from the analysis of a circular piece of DNA (plasmid). A. Use this data to generate a circular map of the plasmid. Pst I: 10 kb Bam HI: 10 kb Sal I: 4.5, 3, 2.5 Sal I + Pst I: 4.5, 3, 2, 0.5 Pst I + Bam HI: 7, 3 Sal I + Bam HI: 4.5, 2.5, 2, 1 B. You have purified the 3 kb Pst I to Bam HI fragment of DNA and have labelled the DNA for use in a Southern blot. If the double cuts are shown were run on a gel, transferred to nitrocellulose, and then analyzed by probe hybridization; which band or bands from each double-cut would be identified?The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I 14. Based on the sequencing results above, what is the sequence of nucleotides as they were added by DNA polymerase to the DNA template? a/ATC-GCA-GTA b. TAG-TGC-CAT c. TAC-TGC-GAT GC-GA TAG-CGT-CAT L A EI la la اد ان YI
- Pictured below is a map of the pBR322 plasmid vector. If a DNA fragment is inserted into the Sal I site, what can be expected about the growth coli transformants containing the recombinant plasmid? EcoRI Pstl Ampicillin resistance (AmpⓇ) Origin of replication (ori) d. All of the above are true pBR322 (4,361 bp) Pvull BamHI Tetracycline resistance (TetⓇ) Sall a. The transformants should grow on nutrient agar containing ampicillin and tetracycline. b. The transformants should be able to grow on nutrient agar without antibiotics. c. The transformants should be able to grown on nutrient agar containing ampicillin1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheIImage 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
- 16. Which of the following enzyme repairs the DNA backbone during molecular cloning (that is you are inserting the DNA fragment into a plasmid and the bases in the sticky ends are aligned but the backbone needs to be repaired). a) reverse transcriptase b) restriction enzymes c) DNA ligase d) polymeraseTo amplify a section of DNA using the polymerase chain reaction (PCR), all you need to load into the tube is 1) a buffer solution, 2) the DNA you want to amplify, 3) some DNA nucleotides, 4) a polymerase (like Taq polymerase), and O an RNA polymerase a set of forward and reverse primers some phospholipids for a cell membrane some ribosomesYou have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.