DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. mRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acid of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).
Q: IV. CENTRAL DOGMA OF MOLECULAR Suppose the following base sequence was found in a 30-base polymer:…
A: Central Dogma: Central dogma is a process by which information from DNA is converted into…
Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…
A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…
Q: In problem 2e, how can you identify added mutations?
A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…
Q: 3. (i) Referring to the genetic code (the codon usage table), what would be the amino acid sequence…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…
A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…
Q: Create an mRNA strand based on the given DNA template strand: TACTTCCTATTTTCTTGTCA CCGCACT Using the…
A: The process of synthesis of RNA with the help of DNA is called transcription and the process of…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: DNA ( deoxyribonucleic acid ) is the hereditary material in humans and almost all other organisms.…
Q: 21a. Fill in the blanks to label each type of molecule in this figure. asp a.TRNA b.amino acids leu…
A: The synthesis of proteins takes two steps: transcription and translation. Transcription takes the…
Q: Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA…
A: Genes are the structural and functional units of heredity. They carry coded genetic information in…
Q: Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA TAG Amino acid coded…
A: Amino acids are the smallest monomers which are known to form the polypeptide sequence of the…
Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA 1.…
A: Information coded in the DNA is transcribed in the form of mRNA, these mRNA then translate this…
Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…
A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…
Q: Let’s practice making a strand of mRNA. Finish what we started: DNA:…
A: Messenger RNA is a single-stranded RNA molecule that is complementary to the DNA strand of a gene.
Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…
A: The given DNA template is TACGATCCGAACCAAACT The mRNA template would be AUGCUAGGCUUGGUUUGA When…
Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…
A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…
Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…
A: Inside the nucleus of the cell , DNA act as a template for the manufacturing of single strand of…
Q: One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic…
A: DNA is the genetic material in living organisms. It carries instructions for making structural and…
Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…
A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…
Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Transcribe the following DNA sequence into codons.…
A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…
Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: Transcription is the process by which RNA is synthesized from DNA. The genetic material is…
Q: Mutations and DNA repair. Francis Crick's "wobble pairing" hypothesis suggested an economical…
A: The process by which the information coded in RNA (mRNA) is decoded into a polypeptide is one of the…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…
Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…
A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…
Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…
A: DNA is the genetic material in humans. It carries information that is transferred from one…
Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…
A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…
Q: From the given DNA base sequence indicated below:…
A: The process by which the information contained in the DNA is converted to RNA is referred to as…
Q: UCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: The genetic information contained in DNA consists of a linear sequence of coding units known as…
A: From the given case, it is known that the E. coli DNA has a size of 4.70 X 106 bps. As, it is given…
Q: 1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction…
A: In a transcription unit; the there are 2 DNA strands. The strand with polarity 3' to 5' is the…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…
A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives…
A: The mRNA codon chart is used to find the amino acid with respect to the particular codon.
Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA MRNA 1.…
A: The 'Central Dogma' is the process which defines that the instructions in DNA are converted into a…
Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…
A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln
Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…
A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…
A: The synthesis of m RNA and t RNA from DNA is called transcription. Thre ribosomes synthesize…
Q: A DNA-binding protein recognizes the following…
A: BASIC INFORMATION NUCLEIC ACID The molecules which hold the ability to carry information of cells…
Q: Replicate this sense strand to create a double-stranded DNA helix…
A: DNA is the store house of general characteristic. The specific sequence of 4 bases in the DNA…
Q: REPLICATION, TRANSCRIPTION, & TRANSLATION REVIEW DNA REPLICATION Fill in the complementary DNA…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysConsider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-TyrThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.
- For the tRNA below, determine which amino acid it is charged with. attached amino acid G G GA 5' end c GOGGAUUU CUC G GAGC G C GCSAK & A 3' end ASSAGGCUUAA GACAC CCUGUG עכטט A GAAD anticodon C T U anticodon loop A GThe following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
- The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.