(c) Determine the amino acid sequence coded by the mRNAstrand:(d) Specify the anticodon present on each of the transferRNA's involved. "Unlike what happens in DNA replication, where both strandsare copied, only one of the two strands is transcribed intoMRNA. The DNA strand that contains the gene is sometimescalled the sense strand, or coding strand, and the DNA strandthat gets transcribed to give RNA is called the antisense strand,or noncoding strand. Because the sense strand and the antisensestrand are complementary, and because the DNA antisensestrand and the newly formed RNA strand are alsocomplementary, the RNA molecule produced duringtranscription is a copy of the DNA sense strand... The onlydifference is that the RNA molecule has a U everywhere theDNA sense strand has a T."Consider the following segment of a DNA sense strand:(5') CAA-ACT-ACG-GCG-TTG-CAG (3’)

Name: (c) Determine the amino acid sequence coded by the mRNAstrand:(d) Spe
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: (c) Determine the amino acid sequence coded by the mRNAstrand:(d) Specify the anticodon present on each of the transferRNA's involved. "Unlike what happens in DNA replication, where both strandsare copied, only one of the two strands is transcribed

Deoxyribonucleic Acid (DNA) is a two-stranded biomolecule. It is a build-up of nucleotides. Distinct…

Answered: strand: (d) Specify the anticodon…

Science

Biology

strand: (d) Specify the anticodon present on each of the transfer RNA's involved.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 2QP: Define replication, transcription, and translation. In what part of the cell does each process...

See similar textbooks

Similar questions

Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
mRNA is produced by ___________. a. replication b. duplication c. transcription d. translation
He sequence is read A DNA sequence before and after replication IS 3 from left to right. The table below shows which mRNA codons code for each type of amino acid. Second mRNA base с U A G DNA sequence before replication: TACCTAGCT UUC - Phe UCC - U UUU- Phe UCU - Ser UAU - Tyr UGU - Cys Ser UAC - Tyr UGC-Cys C UUA - Leu UCA - Ser UAA- Stop UGA - Stop A Leu UCG - Ser UAG - Stop UGG- Trp G Pro CAU - His CGU - Arg U - Pro CAC- His CGC - Arg C DNA sequence after replication: TACCTCGCT UUG Leu CCU CUU CUC Leu CCC CUA- Leu CCA- Pro CAA Gln | CGA- Arg A - Pro CAG - Gln CGG- Arg G AGU- Ser U AGC - Ser C CUG Leu CCG AUU AUC Lys AGA- Arg AGG- Ile ACU Thr AAU - Asn Ile ACC - Thr AAC - Asn ACA - Thr| AAA - ACG - Thr AAG - Lys GCU - Ala GCC - Ala Arg A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes the result of the mutation when the corresponding mRNA sequence is translated? GAU- Asp AUA Ile AUG- Met GUU - Val GUC - Val Val Val GCG - Ala GAC - Asp…
In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA strand. True or false?
The MutH protein nicks the newly synthesized strand (Figure 16-23). How does it “know” which strand this is?
The MutH protein nicks the newly synthesized strand(Figure 16-23). How does it “know” which strand this is?
During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA. What are these 3 proteins and is there an helpful way that can I remember what each of thier functions are?
Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGA How many amino acids does the mRNA strand above code for?
What would happen if any of the stages involved in the translation of DNA to protein were altered/irregular? What effect will this modification have on the protein?
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’