Q: Under the restrictive conditions a conditional mutation expresses its mutant phenotype and under the…
A: Introduction : DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans…
Q: Explain how anatomy and physiology are related.
A: Anatomy is the study of the internal body structure of humans, animals, and other living organisms.…
Q: Explain the control of body temperature
A: Introduction Animals are divided into two groups based on the ability to control body temperature.…
Q: A person has blood type AB negative. Which of the blood types on this list can he receive? OAB…
A: Based on the presence or absence of antibodies and inherited antigenic substances on the surface of…
Q: Make sure that you show a. the breeding pedigree. b. the genotype of each animal represented. c. how…
A: Pedigree breeding is the method used to be about genetic improvement in various organisms to get the…
Q: antibiotics designed to stop narrowly defined categories of infectious microbes be used to discover…
A: Organisms belonging to different species exhibit various forms of interactions between them. Such…
Q: plain with an example- 'enzymes are very powerful cataly
A: A catalyst is a chemical that speeds up a reaction without becoming consumed by it, and enzymes are…
Q: The Hardy-Weinberg principle states that allele and genotype frequencies remain constant from one…
A: There are few important points about Hardy-Weinberg principle : It will relates allelic and…
Q: Name and list the organs of the major organ systems.
A: The organ system includes a group of organs working together to perform one or more function. The…
Q: Early symptoms of mening what other disepse? Ootitis media CI
A: 1]plague develops fever, chills and extreme weakness. There is a severe pain in abdomen or in the…
Q: The mechanism of muscle contraction is best explained by the sliding filament model. According to…
A: Answer :- Correct option is D actin and myosin The mechanism of muscle contraction is best explained…
Q: Describe the types and locations of human body fluids.
A: About 50–60% of the adult human body is made up of water, that is dispersed both inside and outside…
Q: . Explain the importance of homeostasis to survival.
A: Introduction: The act of maintaining the organism's equilibrium or hydraulic balance, known as…
Q: In Protein structure: a). Write the name of the four levels of protein structure,
A: Answer of the question is below,
Q: ir of chromosomes
A: Introduction A chromosome is a condensed state of chromatin material which is the main genetic…
Q: Ob 1. In corn the color purple (P) is dominant to the color yellow (p) and round (R) shape is…
A: Introduction An attempt in producing two creatures that are identical hybrids for two qualities is a…
Q: What are neurotransmitters?
A: The endocrine system is a communication system that uses feedback mechanisms to control far away…
Q: species
A: Dugesia tigrina: Dugesia is a genus of dugesiid triclads which contains some common representatives…
Q: which of the following populations is most likely to be in hardy—weinberg equilibrium a. Northern…
A: Introduction Hardy Weinberg Equilibrium (HWE) States that a population remains in equilibrium until…
Q: Is it possible to get this typed
A: Introduction Antibiotics are the compounds that are used specifically to target and kill bacteria or…
Q: The synthesis of a peptide is given by the mRNA sequence 5'GAAGAGAAACUUACU3', Find the primary…
A: The 'Central Dogma' is the process by which the instructions in DNA are converted into a functional…
Q: Class XII Draw a Explain (A) Seed 1 Fruit Ⓒ Embryo F Pollinadic Draw a List hormon Project R
A: Female embryosac is the female Gametophyte of an angiosperm. It contains two nuclei first is the egg…
Q: Give an explanation for classifying birds and reptiles in a single clade
A: The term "clade" in evolutionary biology refers to a group of species or creatures that share a…
Q: Phenylketonuria (PKU) is an autosomal recessive disease in which individuals with PKU cannot…
A: Phenylketonuria, or PKU, is an uncommon hereditary disorder that results in the buildup of the amino…
Q: What was the Human Genome Project? When was it and give results. What inherit dangers go along with…
A: The human genome project (HGP), an international scientific research endeavour, was successfully…
Q: Consider a set of genotypes with fitnesses: AA = 1.12 Aa = 1.04 aa = 1.0 Where the frequency of…
A: Introduction The process through which populations of living things adapt and evolve is known as…
Q: Entamoeba histolytica
A:
Q: Are all cells in one’s body undergoing the same stage of the mitotic cell cycle at the same time?…
A: Many of our cells develop and become specialised for their specific roles in the body as adults. As…
Q: What component have evolved first, the electron transport chain in chloroplasts or in mitochondria?
A: Following I will be discussing what evolved first the electron transport chain in mitochondria or…
Q: cyclin-cdk complexes
A: The cell cycle is a series of steps where the chromosomes and other cell material double to make two…
Q: 2. Cross a female who is a carrier of the gene for hemophilia with a man who has normal blood…
A: In genetics, crossing two species entails mating them and analysing the offspring to learn more…
Q: Define adaptation and selection pressure. Why are these concepts important in understanding human…
A: Human evolution has been influenced by five major factors: natural selection, mutations,…
Q: escribe two things that contribute to the resting membrane
A: Normal potential inside the cell is called resting membrane potential which is the potential before…
Q: First option is : was not or was Second option is : can or cannot Thrid option: cut, cut and…
A: Restriction digest means the DNA is cut at specific sites called restriction sites by an enzyme…
Q: Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases…
A: Introduction DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: Discuss the parts of the distal and proximal epiphyses of the humerus that form articulations with…
A: Following I will be discussing about proximal and distal joints formed by humerus. A joint or…
Q: What is the principal pacemaker?
A: In its most basic form, biotechnology is simply science based on biology; it uses cellular and…
Q: Draw a labelled diagram of embryo sac and microsporangium
A: In the ovule of flowering plants, there is an oval structure known as the embryo sac or female…
Q: The mark-recapture method is used to estimate the population size of mountain yellow-legged frogs in…
A: The mark-recapture method is a useful tool for estimating the population size of mountain…
Q: in Cohen-Boyer's recombinant DNA procedure _______ must be used for both the bacterial DNA and the…
A: Introduction Cohen and Boyer made recombinant DNA molecules by using inserting a gene of interest…
Q: Make a Balance diagram for a chemical substance?
A: Balance means equilibrium of input and output. Thus, for any chemical substance, the balance is the…
Q: Explain the methods please by bullet points
A: Various respiratory diseases like asthma are heterogenous which makes it harder to predict the…
Q: Explain delicate nature of infants deveolpment.
A: Infanthood is the time between birth and the beginning of language development in humans, which…
Q: What are the two ways fluid is gained? What are the two ways water is lost?
A: The human body uses and loses water every day. When you lose more water or fluid than your body can…
Q: Which of the following hormone describes the signal transduction mechanisms for estrogen a steroid…
A: Introduction: Androgens, estrogens, glucocorticoids, mineralocorticoids, and progestins are all…
Q: Match the description with the correct term. • a common ancestor diversifies and the various species…
A: Introduction Any overall change in an organism's or population's features over a significant number…
Q: Match each organism to the most likely life strategy and growth type Organism Life Strategy…
A: Logistics growth pattern In a logistic growth, population growth rate slows down as it started to…
Q: Describe the factors that affects the pro-environmental behavior.
A: Pollution and climate change caused human activities alarms a need for protection of environment for…
Q: Name a gene that will disrupt somitogenesis and describe its effects on formation of the axial…
A: Introduction: Somitogenesis is the process through which somites form. Sockets are bilaterally…
Q: Which of the following statements is true regarding DNA replication? Select all true statements. DA…
A: DNA replication is a process by which two identical copy of DNA is produced from single original DNA…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The peptide hormone oxytocin induces labor by stimulating the concentration of uterine smooth muscle. Its amino acid sequence is as follows: Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly.
Write a messenger RNA sequence for that sequence. Write the sequence of the two strands of DNA
Step by step
Solved in 2 steps
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC ТСС САТ стт ААС АAА GAG GTT GG C TAT TT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC ТСС САТ стТ ААС АAG GAG GTT GGC ТАТ ТТT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe missense nonsense frame-shift silent antisenseCompare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТ Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT T Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- missense nonsense antisense O frame-shift silent
- The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- Choose a pentapeptied composed of five different amino acids. List the five amino acids. Present the messenger RNA codons for the amino acids and the sequence of the nucleotids on the DNA that was originally coded for the pentapeptide.Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........
- A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Trp-Arg-Thr-Gin Ser-Trp-Arg-His-Trp-Ala-Lys Asp-Val-Ala-Ala-Lys Asn-Ser-Asn-Val-Ile-Arg The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Arg-His-Trp Arg-Thr-Gin Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp The original peptide sequence was: Asp-Val-Ala-Ala-Lys-Ser-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-His-Trp-Arg-Thr-Gin Asp-Val-Ala-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin-Ser-Trp-Arg-His-Trp-Ala-Lys Trp-Arg-Thr-Gin-Asn-Ser-Asn-Val-Ile-Arg-Ser-Trp-Arg-His-Trp-Ala-Lys-Asp-Val-Ala-Ala-Lys Arg-His-Trp-Arg-Thr-Gln-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Asp-Val-Ala-Ala-Lys-Ser-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp-Arg-His-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin…The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineThe genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?