Spliceosomes include all of the following EXCEPT enzymes catalyzing acetylation of histone proteins snRNPs RNA-annealing proteins ATP-dependent RNA-unwinding protein
Q: How many molecules of ATP are generated by the complete mitochondrial beta oxidation of the…
A: Nervonic acid is a 24 carbon fatty acid with a double bond between the 15th and 16th carbon atom…
Q: Linear homoglycan of glucose connected by α1-4 linkages…
A: Polyssacharides are the long chains of carbohydrate molecules which are composed of several units of…
Q: What is the difference between isologous and heterologous oligomerization?
A: Oligomerization is defined as a chemical process that is made used in order to convert the monomers…
Q: Draw the dipeptide that results when a peptide bond is formed between the two glycine molecules…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…
Q: Does oxidase, catalyzes the oxidation of molecular oxygen? True or False
A: Enzymes are biological catalysts that are proteins. Chemical reactions are sped up with catalysts.…
Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False
A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…
Q: Which of the following lipids is NOT found in biological membranes? glycolipids…
A: Glycolipids are substances expressed on the surface of cellular membrane. Glycolipids are lipids…
Q: Fructose, sucrose, lactose, xylose, and glucose were tested using Benedict's, Barfoed's, Bial's, and…
A: Carbohydrates are the organic compounds and is the main source of energy for the body. They occur in…
Q: cholesterol
A: Cholesterol is the major and most abundant sterol in animal tissues. It is amphipathic, with a…
Q: a. Is the disaccharide below a non-reducing sugar? yes or no b. The glycosidic linkage in the…
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…
Q: TRUE OR FALSE: a) DNA replication requires the participation of at least 8 nucleoside…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Which of the following is true regarding the glycosidic bond between the pentose sugar and…
A: DNA and RNA are nucleic acids composed of nucleotide units. Nucleotides are composed of pentose…
Q: Assume you were given a mixture consisting of one molecule each of all possible sequences of a…
A: Proteins are long chains of single amino acids. The human body uses 20 different amino acids in…
Q: hain elongation of monosaccharides can be done in the laboratory thru Ruff reaction. True False
A: The Ruff degradation is the process of converting an aldose to its analogue with one less carbon…
Q: How many chromosomes are there in a body cell of a person with trisomy 21 condition? Select one: О…
A: Trisomy 21 is a genetic chromosomal disorder . Genetic chromosomal disorders are the diesese occurs…
Q: Discuss models for how amyloid fibrils form from unfolded or misfolded proteins and for how the cell…
A: Misfolded proteins result in many degenerative diseases and this often occurs due to several…
Q: What type of spontaneous change to DNA is caused by UV light? deamination
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: TRUE or FALSE: Lipids may originate through carbocation-based condensation of thioesters or by…
A: Introduction: Lipids are a heterogeneous group of biomolecules that includes fats, oils, waxes,…
Q: explain the prevention, control, and treatment of Parkinson's disease?
A: Parkinson's diseases is a progressive neurodegenerative disorder that leads to shaking, stiffness…
Q: Transverion mutations result from
A: Mutation is a change in nucleotide sequence in a polynucleotide chain. This can be natural or…
Q: Five amino acids were subjected to normal phase chromatography, and the folkowing Rf val were…
A: Chromatography is the technique of separation of components of a mixture based on their physical…
Q: Which of the following functions is NOT or cannot be performed by lipids? They can serve as chemical…
A: Answer: Definition: Lipids are the organic, water insoluble compounds. Eg: wax, sterols, oils,…
Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…
Q: Explain how ATP levels regulate glycolysis in resting muscle
A: Glycolysis is a catabolic pathway in which carbohydrates are oxidized to two molecules of pyruvate.…
Q: D. Lactate
A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…
Q: topic: gel electrophoresis What is the purpose of the running buffer?
A: The gel electrophoresis is a biochemical technique, which helps to separate the proteins and DNA,…
Q: Determine the vitamin content of the following fruits and vegetables using…
A: Introduction: Vitamins are organic compounds present in food that are needed in minimal amounts for…
Q: Enzymes that acetylate the ε-amino group of lysine in the histone tails are called ____ and are…
A: Histones are protein molecules present in nucleosome core of the chromatin material around the…
Q: Explain the term ‘buffer capacity’.
A: An aqueous buffer solution is made up of a weak acid and its conjugate base, or vice versa. When a…
Q: A monosaccharide that consists of 5 carbon atoms, one of which is in a ketonegroup, is classified as…
A: Monosaccharides are simplest unit or basic unit of carbohydrate. general formula is CnH2nOn. it can…
Q: 7. The attachment of phosphoryl groups to specific amino acid residues is catalyzed by a) Diphteria…
A:
Q: What is the difference between gain of function and loss of function mutations?
A: Mutations is a change in a DNA sequence that can be caused due to DNA replication error made during…
Q: Which polymerase transcribes genes with internal control regions (ICR)? ORNA Pol I RNA Pol III RNA…
A: DNA sequences located within the coding region of eukaryotic genes that bind regulatory elements…
Q: How many ATP couny after complete oxidation 1 mol glucose
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: Explain how amino acids can be used a source of energy, and outline how ammonia is detoxified
A: Amino acids are an essential component of the body. They take part in several different functions of…
Q: Different types of mutations and how to use the genetic code table.
A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…
Q: 7. What is represented in the following diagram? Pyruvate Lactate Acetyl-coA dehydrogenase…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Self-splicing introns are called ribosomes splicing enhancers ribozymes intron silencer
A: Self splicing introns : These can catalyze their own excision from the mRNA, the tRNA, rRNA…
Q: Acetyl CoA + 2H* + 2e = pyruvate + COASH Ubiquinone + 2H* + 2e = Ubiquinol E* = -0.48 V E" = +0.04 V…
A: If the reaction has a positive value of standard cell potential/standard reduction potential or a…
Q: Explain the meaning of metabolic interconversion
A: Metabolism is the body's cells is used for changing the food into energy. The human bodies need this…
Q: Solve the following problems using the basic assumptions: 1 NADH --> 2.5 ATP; 1 FADH2 --> 1.5 ATP…
A: When there is no carbohydrates available in the body, the fatty acids undergo β-oxidation to yield…
Q: Which of the following compounds is derived from arachidonic acid with the help of the enzyme…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Write the following oligopeptide using the one letter code for the amino acids: Cys-His-lle-Leu-Glu…
A: One letter code has been assigned to each and every amino acids and is often used to represent the…
Q: What is the name of proteins that relax supercoiled state of a DNA molecule are called? Polymerase…
A: During the process of transcription and DNA replication overwinding of the DNA duplex would lead to…
Q: If radio-labeled C-5 of glucose is used for glycolysis and alcoholic fermentation, which carbon in…
A: Glycolysis and alcoholic fermentation are both anaerobic reactions that begin with glucose. This…
Q: (a) Q1 a. Justify why the base thyamine is prefered over guanine in DNA while the reverse is…
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: Identify Four (4) possibilities in cell culture practices that able affect the quality and yield of…
A: Cell culture It is a method of growing the cells in artificial condition i.e. cells are grown…
Q: Enhancer sequences may be very far from the genes they affect but they are always upstream of the…
A: Enhancer sequence : These are regulatory DNA sequences, when these are bound by transcription…
Q: CH;OH CH2OH O, H H H. Он H OH OH OH ÓH
A: A disaccharide is composed of two monosaccharide units. Carbohydrates are composed of carbon,…
Q: Consider each of the following disaccharides: a) Label the acetal and hemiacetal in each…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Spliceosomes include all of the following EXCEPT
-
enzymes catalyzing acetylation of histone proteins
-
snRNPs
-
RNA-annealing proteins
-
ATP-dependent RNA-unwinding proteins
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- There are two ways in which rearrangement of domain- encoding gene segments can result in novel protein functions. Which of the following is NOT included? Domain shuffling Domain duplication Domain replication Domain substitution Which of the following features are NOT shared by prokaryotic and eukaryotic cells? shared metabolic pathways similar mechanism for synthesizing and inserting membrane proteins plasma membrane of similar structure nucleosomes of similar constructionDescribe in general terms the histone code hypothesisGenetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tail
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- (b) (c) Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3-TAC CGG TTG TGA AGC TGA ATC-5' Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. (i) (ii) (iii) (iv) Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. Specify which of the point mutations identified in (d) are redundant? For the given tRNA for Thrombin (Thr) write down all…Describe the packaging of chromosomal DNA by histones with diagrammatic representations. Name the various histone modifications and describe any two among them.describe mRNA splicing
- Histones are: Group of answer choices Are present in eukaryotic, but not prokaryotic chromosomes All of these are true Have tails that can be modified and thereby change how actively a gene is transcribed Generally positively charged Are the protein components of nucleosomesDefine both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.