Draw the dipeptide that results when a peptide bond is formed between the two glycine molecules shown here. Draw it as it would occur at the pH of most body fluids. Include all hydrogen atoms

Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…

A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…

Q: Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA…

A: mRNA is the product of transcription formed from DNA by RNA polymerase. This mRNA is important for…

Q: Glucose is phosphorylated to glucose-6-phosphate by hexokinase in the first step of the glycolytic…

A: Reactions that have a positive value of Delta G are not favorable in nature. Hence in order to…

Q: What process do all macromolecules have in common?

A: Biological macromolecules are always categorized as organic molecules because they include carbon in…

Q: In olfactory neurons, it is estimated that activation of the olfactory receptors results in an…

A: The olfactory epithelium of the nasal roof contains olfactory receptors. Each olfactory receptor is…

Q: chemicals being applied for the leafy vegetables to produce seeds? If yes,

A: In today's world , almost all grown vegetables are being sprayed with pesticides, fungicides and…

Q: a) Which catalytic mechanism occurs in step 2? b) Why must phosphate first bind to succinyl-CoA…

A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Respiration is an oxidative…

Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: n circulatory system, one the main function of our blood is controlling our body temperature.…

A: Blood is one of the connective tissues that absorbs and distributes heat throughout the body.

Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?

A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…

Q: alculate the free energy change for glucose entry into cells when the extracellular concentration is…

A: An amount of energy is released in the conversion of reactants to products under standard conditions…

Q: Consult a biochemistry textbook or handbook: What is the molecular weight of hemoglobin A and S (in…

A: Hemoglobin is a tetrameric protein, which carry oxygen from lungs to the body cells, and carbon…

Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…

A: The RBCs are the cells which carry oxygen to various tissues. The RBCs yield energy from the…

Q: Basic structural component of Lipids, Protein and Enzymes?

A: A biomolecule, sometimes called a biological molecule, is any of the numerous chemicals produced by…

Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…

A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…

Q: Please solve all part.                             9. If 32p-labeled inorganic phosphate were…

A: Glycolysis is undergoing here i.e conversion of the glucose to pyruvate molecules, and we assume…

Q: According to the search results from question 7, which of the following lipids is (currently) only…

A: Human body contains many sialic acid containing gangliosides or glycosphingolipids such as GM1,…

Q: te the structure for a generic triacylglyceride at pH 7.4.

A: ''Since you have asked multiple question , we will solve the first question for you . If you want…

Q: 3. sports amp. Intensively pool for 120 minutes two hours after each meal. What metabolic changes of…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…

Q: . Adding as little as 0.1 mL of concentrated HCl to a liter of H20 shifts the pH from 7.0 to 3.0.…

A: Acetic acid and sodium acetate is an example of the acid - base buffer, in order to understand how…

Q: Why are they so designated?   Ketone bodies are so named because they contain the ketone functional…

A: Ketone bodies are produced by the liver during caloric restriction.

Q: (a) Lock and key model versus induced fit model of enzyme activity.

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 1. What are the major functions of lipids?

A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…

Q: Concentration Substrate/Cofactor (nM)

A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…

Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…

A: Pyruvate kinase is an glycolytic enzyme, which catalyzes the conversion of phosphoenolpyruvate (PEP)…

Q: Why are unsaturated fats considered healthier?

A: Unsaturated fatty acids consist of a double bond between molecules of the fatty acid chains, whereas…

Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…

A: In the last 40 years, scientific understanding of retroviruses has increased dramatically. The word…

Q: Which of the following enzyme catalyzes the first step of glycolysis?   Group of answer choices…

A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.

Q: Why is understanding reaction rates significant? Indicate at least 3 key importance of understanding…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…

Q: 7. What are the current treatments for PK deficiency patients?

A: Pyruvate kinase deficiency is a genetic inability to make the enzyme pyruvate kinase, which is…

Q: HbA1c is a glycated hemoglobin in which a glucose molecule is covalently bound to the N-terminal…

A: Hemoglobin is an iron-containing oxygen-transport metalloprotein found in nearly all vertebrates'…

Q: Which of the following is NOT true regarding nicotine?   a. its psychoactive effects include…

A: Nicotine is a toxic substance present in tobacco. Nicotine is addictive and is hard to quit. It…

Q: Consider each of the following disaccharides: a) Label the acetal and hemiacetal in each…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Reactions and Thermodynamics of Glycolysis

A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…

Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…

A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…

Q: Which of the following processes generates the most ATP? (Account for the no. of ATP) a. ) Citric…

A: The human body is a complex system that requires energy to operate effectively. At the cellular…

Q: [S] Vo vo with I 0.00 0.00 0.00 1. 15 2. 14 0. 60 0. 25 0. 50 1. 15 2. 14 3. 75 6. 00 8. 57 1.00…

A: The plot is given in step 2

Q: 4. Enzymes in an enzymatic reaction do not interfere with: a. free energy of reaction b. rate of…

A: Enzymes are the biological catalysts that speed up the rate of reaction by lowering the activation…

Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond donor…

A: The α-helix is an ordered secondary conformation of proteins. An α-helix is stabilized by the…

Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…

A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…

Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…

A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…

Q: 3. How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function

A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: Is it somehow possible to generate carbohydrate from non-carbohydrate? If yes, how and if no, why?

A: Carbohydrates are organic molecules, which act as the primary source of energy. Glucose is the…

Q: Aldolase is a key enzyme in glycolysis that catalyzes the cleavage of its substrate,…

A: During glycolysis, Aldolase catalyzes the cleavage of its substrate fructose-1,6-bisphosphate into…

Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…

A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…

Q: What are the steps in extracting DNA from a Banana using simple household materials like dishwashing…

A: DNA extraction from banana is most commonly followed as banana is triploid with three sets of…

Q: sunganegy Two dialysis membranes each containing a methylene blue solution were placed in beakers of…

A: In dialysis, colloids are separated from dissolved ions or molecules of small dimensions or…

Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Complete the table below by supplying AT LEAST ONE example of a monomer with its polymer for each…

A: Lipids are hydrophobic or hydrophilic bio macromolecules which can be of several types like fatty…