RNA sequencing can detect DNA mutations typically easier to analyze can detect transcripts with very low abundance Both Answer Bank used for gene-expression analysis Microarray requires transcript-specific probes
Q: 1. For the following cross: Aa Bb cc Dd x Aa Bb CC Dd what is the chance of obtaining an…
A: Introduction : The study of genes and variations is referred to as genetics. It explains how traits…
Q: Select all of the functions that ATP can be used for. Transport substances across plasma membrane…
A: -Answer and explanation Transport substances across plasma membrane - Active TransportMovement of…
Q: Chromosomal translocations AND mutations in cadherin binding sites can result in cancer. Select one:…
A: When a segment of one chromosome separates and joins another chromosome, the process is known as a…
Q: Which of the following is an example of passive rest? Complete rest Circuit training Low intensity…
A: Physical rest are of two types, active and passive. Active rest involves staying physically active…
Q: In humans, the allele for normal blood clotting, H, is dominant to the allele for hemophilia, h. The…
A: Hemophilia is an inherited condition of bleeding. Children with haemophilia cannot stop bleeding…
Q: ou are amplifying both gst::egfp mRNA and 23S rRNA in the PCR steps. These are two different types…
A: The DNA in the nucleus makes different types of mRNA via transcription. Different types of mRNA have…
Q: A fox's diploid number of chromosomes is 36. How would the number of chromosomes in the fox's body…
A: The cell is the basic unit of life and it contains the genetic material in the DNA. The DNA is…
Q: B complex vitamins major function is to_____ Group of answer choices All of the above Act as…
A: People require trace amounts of organic substances called vitamins. The body either cannot make…
Q: Discuss two-three ways that kinases/phosphatases OR proteasomes ensures proper rates of cell…
A: In order for duplicated chromosomes to bind appropriately to spindle microtubules and partition…
Q: 1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 31…
A: The DNA sequence is replicated to produce daughter DNA which is the same as the parent DNA. Further,…
Q: a b с d Termites benefit from protists. There are bacteria inside the protists. They cannot survive…
A: Ans- An endosymbiont is an organism that loves inside the body of the another organism. Obligate…
Q: Based on the data provided, explain how cellular processes must be altered in stomach cancer cells…
A: In comparison to healthy cells, cancer cells have an active metabolism and need more energy. Cancer…
Q: What is the correct chromosomal condition at late prophase (prometaphase) of mitosis? _____________…
A: Introduction : The cell cycle is an organised group of steps. DNA replication and cell expansion…
Q: C. b. For each of the 5 STR loci, draw the expected pattern of bands on the gel below. Show the…
A: Short tandem repeats (STRs) These are microsatellites having short tandem repeated DNA sequences of…
Q: Draw the three components of DNA. Draw 2'-deoxyribose. Draw guanine. Draw phosphate in the form of…
A: DNA is self replicating biomolecules that are present in the chromosomes and acts as store house of…
Q: How do we improve or harm or gut flora?
A: Gut flora includes the microbes that are found in our digestive tracts. These are different species…
Q: Which oof the following is NOT one of the function of the liver? A) secretion of bile B) nutrient…
A: The liver is the biggest organ in the human body. Approximately the size of a football, it is…
Q: The absence of p53 ____ the cell cycle. The absence of retinoblastoma ____ the cell cycle. Select…
A: A cell's growth and division are accompanied by a sequence of processes known as a cell cycle. A…
Q: Which of the following states about Basal Metabolic Rate is NOT true? A) Basal Metabolic Rate is…
A: The basal metabolic rate (BMR) calculates the bare minimum of energy required for a person to…
Q: flower (a peace lily) complete or incomplete? explain your reason. note: Complete flowers have all…
A: Complete flower: A flower which has all the basic floral organs i.e., sepals, petals, carpels and…
Q: Establish the most regulated reactions of the Krebs cycle.
A: Introduction: The Krebs cycle, sometimes called the TCA cycle or the citric acid cycle, is a series…
Q: A mutation in p21 that destroys its binding site will
A:
Q: A particular mature miRNA (microRNA) in mice has sequence 5'-UUCCCUGAGACCUCAAGUGUGA-3'. a. If you…
A: Answer a) ii and iii ii) mRNA sequence complementary to the miRNA sequence iii) miRNA sequence with…
Q: Determine Whether a telephone conversation is analogous to autocrine, paracrine, endocrine, and…
A: Signal transmission from one cell to the target cell is a part of cell-cell communication. It is…
Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…
A: The given strand represents the complimentary strand of DNA. The complimentary strand. Given the…
Q: a.) Infection with this pathogen can result in a wide range of diseases from ear infections to…
A: Introduction The meningitis is the inflammation of the meninges layer of the brain and the…
Q: Which of the diagrams below best represents the structure of an oligosaccharide? Select one: Oa. us…
A: Oligosaccharides are a type of carbohydrates that is composed of 2-10 monosaccharide units. The…
Q: 11. The immediate source of energy for DNA replication is (a) the hydrolysis of nucleotides with…
A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: The synthesis pathway for RNA nucleotides utilized multiple amino acids as reactants. DNA…
A: Introduction Miller-Urey experiment:- It is the experiment that suggests that organic molecules…
Q: Chromosomal translocations AND mutations in cadherin binding sites can result in cancer. Select one:…
A: Introduction: When a segment of one chromosome separates and joins another chromosome, the process…
Q: Which of these observations provides evidence that we have several types of taste receptor? A.…
A: Sweet foods have always appealed to humans. Humans have loved nutritive sweeteners such as honey and…
Q: I need help with a biology lab question, a DNA isolation lab Cold temperatures were used to…
A: Ionic ions and DNA dissolve quickly in water, but not so easily in ethanol or isopropanol, since…
Q: what is a hominin fossil that discusses contrasting perspectives (lumper vs. splitter) of taxonomic…
A: The hominin fossil is the fossils of the Hominini subfamily which includes the Homo and Pan groups…
Q: What two features characterize a Schwann cell, but not an oligodendrocyte? open cytoplasmic…
A: The neuroglial/glial cells and neurons are the cells that form the nervous system. The glial cells…
Q: Protein kinase A is activated by: phosphorylation of its catalytic subunit phosphorylation of its…
A: Protein kinase A (PKA) : Protein kinase A is a proteolytic enzyme that is cAMP-dependent. It is an…
Q: A parent is homozygotic for the allele , T, at three of five loci for an additive trait and…
A: Alternate DNA sequence in the genomic location is called as alleles. The simple ones are single…
Q: What function do alveolar macrophages serve What would happen to the respiration of an individual…
A: alveolar macrophages are the immune cells present in the luminal surface of the alveolar space in…
Q: Explore the background and historical depth to understand why animals and humans are used in…
A: Animals play an important role in determining the research aspects in the medicines, medical studies…
Q: The protein cohesin is most likely made soon after_ Select one: a. G phase b. prophase Oc. S phase…
A: The cell cycle involves the series of events which take place in a cell when it grows and divides.…
Q: Which of the following best explains how the structure of DNA determines the structure of proteins?…
A: DNA is called a genetic element because it is transmitted from one generation to other maintaining…
Q: What is the relationship between the resolution power and the useful magnification that may be…
A: The area of science which focuses with microbes is called microbiology. Discussions of microbiology…
Q: select all of the processes from below which describe changes which are independent of the path by…
A: In these examples, the variables should be defined whether they are state function or path…
Q: a. What enzyme works on glucose-6-P when the energy charge is 0.80? b. What enzyme works on…
A: Introduction Glycolysis, the first stage of the aerobic cell respiration, is a process in which…
Q: In the experiments below, different prokaryotic cells were grown in broth cultures in the presence…
A: Antibiotic resistance arises when changes in bacteria make antibiotics less effective in treating…
Q: 1. Name the organ in CNS that affects your temptation to eat an apple. 2. Name the organ in CNS that…
A: introduction The brain and spinal cord make up the central nervous system (CNS) of the body. The…
Q: What is the response that the humoral immunity arm of the adaptive immunity will mount to try to…
A: The immune system protects our body from harmful substances and cellular changes which can make a…
Q: Discuss reticulocyte production index (RPI), absolute reticulocyte count, and corrected reticulocyte…
A: Reticulocytes are immature forms of red blood cells. Red blood cells are formed from precursor cell…
Q: Create a graphic organizer to present a summary of the similarities, differences and significance of…
A: "Cell damage" or "cell injury" is a type of stress that a cell experiences as a result of external…
Q: Many administrators believe the oversite of the LIS system be under the direction of the hospital IT…
A: The way our hospitals and other medical institutions operate has been fundamentally changed by IT.…
Q: Down syndrome is a genetic disorder that is also called trisomy 21. A person with Down Syndrome has…
A: Introduction Down syndrome is also known as 21st trisomy that occurs due to the presence of an…
![RNA sequencing
can detect DNA mutations
typically easier to analyze
can detect transcripts with very low abundance
Both
Answer Bank
used for gene-expression analysis
Microarray
requires transcript-specific probes](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fa5d0ed69-4925-4403-a796-f6681910a505%2F9e4d48fe-be26-43da-98e6-72a313ef340c%2Fj5174ku_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.Terminal-sequencing reads of clone inserts are a routinepart of genome sequencing. How is the central part ofthe clone insert ever obtained?Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
- acconline.austincc.edu/ultra/courses/_891351_1/cl/outline O gel electrophoresis O PCR O genomic library DNA microarray A patient is suspected of having a certain type of cancer that involves several genes. Doctors want to determine whether this patient is expressing these cancer genes and to what leve each gene is being expressed. What technique may be used? O molecular cloning O CRISPR gene editing 5 genetic recombination that occurs naturally (think horizontal gene transfer, meioșis, fertilization, or mutations). Ar : Y EV АУ ΩΘΙ 用く X A MacBook Air & 8 88 Q V Ix % 0 8A EXE D B 图 Q 用图 5 d Show All † 19 EHR ImmunizaCA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutationTALENs What is it? And how it works in genome editing? Including additional figures pls At least 1-2 page
- 1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…
- BIOINFORMATICS Please solve the questions about(Akt 1) can use NCBI Please help me 1.What is the official genename of the gene? Do you have another names? 2.Find nucleotide sequence of reference sequence of your gene. 3.Find refseq transcript number of your gene. Make BLAST of two of refseq transcript. Show the Blast result. (You can take screenshots) 4.Find refseq protein sequence number of your gene. And download the amino acid sequence of your gene. 5.What is the chromosome number is it located? 6.What are the coordinates of the gene? 7.How many bp is the length of the transcript? (Hint: not RefSeq transcript) 8.What is the transcript access number? 9.How many exons and introns does it have? 10. What is the sequence of the first exon? 11.How many nucleotides long is each exon? 12. What is the UniProt accesion number of your genes for human?Consulting Table 4.1, determine the length and the nature (59 or 39) of the overhang (if any) created by the following restriction endonucleases: a. Alul b. Bglll с. Clal d. Кpnl e. Mbol f. Pyul g. Not! Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Recognition Sequence* Alul AGICT BamHI GIGATCC Bgl| AIGATCT Clal ATICGAT EcoRI GIAATTC Haelll GGICC GTPY I Pu A C ALAGCIT Hindll Hindll Нраll CICGG Kpnl GGTACIC Mbol ĮGATC Pstl CTGCALG Pvul CGATICG Sall GITCGAC Smal CCCIGGG Xmal CICCGGG Notl GCIGGCCGC *Only one DNA strand, written 5'3' left to right is presented, but restriction endonucleases actually cut double-stranded DNA as illustrated in the text for EcoRI. The cutting site for each enzyme is represented by an arrow.Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)