Review transcription. Match the term and its description. Each term can only be used once. RNA synthesis is catalyzed by this enzyme called |Choose The DNA sequence where RNA polymerase attaches is called | Choose | In bacteria, the sequence signaling the end of transcription is called Choose J The stretch of DNA that is transcribed is called | Choose These factors mediate the binding of RNA polymerase and the initiation of transcription (Choose >

Review transcription. Match the term and its description. Each term can only be used once. RNA synthesis is catalyzed by this enzyme called |Choose The DNA sequence where RNA polymerase attaches is called | Choose | In bacteria, the sequence signaling the end of transcription is called Choose J The stretch of DNA that is transcribed is called | Choose These factors mediate the binding of RNA polymerase and the initiation of transcription (Choose >

Name: nd its description. Each term can only be used once.led[ Choose J( Ch
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: nd its description. Each term can only be used once.led[ Choose J( Choose]Caches is calledTranscription factorsanscrip.ion is calledtranscription initiation complexRNA polymerasepromoterterminatorrase and thetranscription unitings except Question 3R

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 7P

See similar textbooks

Similar questions

Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
Question 7 Review translation. Match the term and its description. Each term can only be used once. transfer amino acids to the growing polypeptide in a ribosome |Choose | these base-pairs of a ERNA with a complementary codon on MRNA [ Choose J The two ribosomal subunits (large and small) are made of proteins | Choose | and this RNA called >
I am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
Question 2 Match the term and its description. Each term can only be used once. a series of nonoverlapping, three-nucleotide words [Choose J This DNA strand provides a template for ordering the sequence of complementary nucleotides in an RNA transcript | Choose ) the MRNA base triplets [ Choose J Codons must be read in the correct groupings in order for the specified polypeptide to be produced. These correct groupings are [ Choose J called > > > >
QUESTION 7 UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence that forms a "hairpin" stem-loop structure, followed in the direction of transcription by a polyuridine (polyU) sequence, as shown in the figure above. Which of the following template strand DNA sequences, when transcribed, will form a terminator structure in the transcript? 5 CCGACGTATCCGACGTTTTTTTT3' 5'AAAAAAAACCGACGTATCGTCGG3' 5 CCGACGTATCGTCGGAAAAAAAA3' 5 TTTTTTTTCCGACGTATCGTCGG3' 5 AAAAAAAACCGACGTATGCAGCC3'
Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А А
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic bond connect the phosphate group to ribose. Before the mRNA can be used in translation, it has to undergo splicing, 3’ cap and 5' poly-A tail post-transcription modifications.
Choose the best answer. transcriptional bubble in prokaryotes is produced by… Group of answer choices TFIID TFIIH Sigma factor and RNA polymerase TATA-Binding Protein Which polymerase transcribes the coding sequences of mRNAs in eukaryotes? Group of answer choices Poly(A) Polymerase RNA Polymerase I RNA Polymerase II RNA Polymerase III What role does TFIID play in transcription? Group of answer choices TFIID binds to the terminator sequence to stop transcription. TFIID acts as a regulatory kinase and helicase. TFIID prevents RNA polymerase II from associating with non-promoter sequences. TFIID binds to the INR and DPE sequences to distort the promoter sequences.
TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.
PLEASE ANSWER ALL OF THEM. THEY ARE ALL CONNECTED MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA. 1.. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 2. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 3. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 4. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 5. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)