Question 39 The graphic below shows Taq polymerase extending the primer upon a strand of DNA. What is a possible resulting sequence of the complementary strand after the reaction is finished assuming adequate amounts of all normal nucleotides and some ddGTP? 5' 5' GATGC O TGCG ATGC AGATGC с POLYMERASE 3' T G с '5' 3° in
Q: 2. ( Labeling molecules with isotopes has long been used to trace and characterize metabolic…
A:
Q: In a resting human axon, the concentration of K+ inside the axon is maintained at 375 mM while the…
A: We use the Nernst equation to find the contribution of an ion towards the the resting membrane…
Q: 3. Assuming that there are 5 x 1013 cells in the human body and that ATP is turning over at a rate…
A: We have to find out how many watts the human body consuming.
Q: What is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated i the Figure…
A: Enzyme deploy different chemical mechanisms to catalyse biochemical reactions. One such mechanism is…
Q: When substrate concentration [S] << Km, the rate of an enzymatic reaction is increased by O…
A: The enzymes are biological catalysts that increase the rate of biochemical reactions.The enzymes are…
Q: The Bohr effect describes the: cooperativity of hemoglobin in the presence of CO. effect of hydrogen…
A: A protein called haemoglobin contains iron and helps red blood cells carry oxygen. The blood's…
Q: How do you measure the amount of µmoles of a substance from absorbance? If the absorbance is 0.019,…
A: The objective of this question is to calculate the amount of micromoles of a substance from its…
Q: The initial rate for an enzyme-catalyzed reaction has been determined at a number of substrate…
A: MM plot is Michaelis Menten plot which is constructed by taking Substrate concentration on X axis…
Q: Which of the following is true? Please select all the descriptions that are true. The proton-motive…
A: The proton motive force is the inherent potential energy in the protons of Inter Membrane Space…
Q: The end product of protein digestion is: a) monosaccharides b) glycerol and fatty acids c)…
A: The objective of these questions is to test the understanding of various biochemical processes,…
Q: Identify which of the statements below is/are true regarding the "kinase" family of enzymes.…
A: Enzymes are the proteins that speed up chemical reactions in the biological system. Substrates are…
Q: **Please answer as soon as possible!!!** Can you check if the answer below is correct/has correct…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: A mutated form of the a subunit of the heterotrimeric G protein has been identified. It is found to…
A: Heterotrimeric G proteins have 3 subunits; , and . GPCRs (G protein coupled receptors) are…
Q: 3. Show that the inverse of equation 29-78 in the textbook gives the Lineweaver-Burk Equation. The…
A: The Michaelis-Menten (MM) equation is the general equation used in most enzyme kinetic studies. The…
Q: In Fehling’s test, aldose are oxidized to aldonic acid. Kindly give the reaction and mechanism of…
A: Fehling's test is a chemical test used to distinguish the presence of reduced sugars in a given…
Q: chromatography
A: Hydrophobic interaction chromatography segregates molecules by their degree of hydrophobicity.The…
Q: Calculate the ATP yield for the complete oxidation of the ketone body 3-hydroxybutryate to 4 CO2 in…
A: Steps involving production formation of 3-hyroxybutryate to CO23-hyroxybutryate (4 Carbon) to…
Q: Which C-C is most likely to be broken by aldolase? CH₂-OPO3²- I C=O I HO-C-H I H-C-OH H-C-OH…
A: Enzymes are biological catalysts that increase rate of biochemical reactions. Aldolase is an enzyme…
Q: Lipids in a bilayer can diffuse laterally at a relatively fast rate, but "flip-flop" from one…
A: Flippases, floppases, and scramblases are phospholipid translocators present in the membrane…
Q: Membrane-spanning proteins are notoriously difficult to characterize by x-ray crystallography.…
A: The biological membranes consist of a bi-layer of phospholipid molecules.In addition, there membrane…
Q: most organisms use D-glucose as a primary metabolic fuel. predict what would happen if only…
A: The question is asking us to predict the metabolic consequences if organisms, which normally use…
Q: Which of the following glucocorticoids is hydrocortisone and expected to have the LEAST binding…
A: Gluco-corticoids belong to the class of corticosteroids. They belong to the class of steroids. They…
Q: The site of translation is the a) nucleus b) ribosomes c) lysosomes d) mitochondria Which…
A: The site of translation in a cell is the ribosome. Ribosomes are the cellular structures responsible…
Q: 1. Answer the following problem and explain your answer for better understanding Which of the…
A: They are the simplest form of fats that are linear unbranched chains of CH2 groups linked together…
Q: Identify the following lipids as wax, triglyceride, eicasanoid, phospholipid, or steroid 1.
A: We are given four lipid structures and we have been asked to identify the type of lipid.Lipids are…
Q: 19. Endorphins are polypeptides that reduce pain. What is the amino acid order for the following…
A: The body produces endorphins, which are neurotransmitters that can provide sensations of pleasure or…
Q: Fill the sentence in with the right keyword: Anabolic reactions Sometimes or Alwasys consume energy.
A: When a chemical reaction takes place energy is either taken in or released. Depending on the…
Q: The characterization of an enzyme usually includes the determination of key kinetic parameters.…
A: vo: initial rate of reaction or rate of reaction when all the enzyme is yet to be saturated with…
Q: What would be a likely consequence if step 4 of the citric acid cycle no longer operated far from…
A: Step 4 of the citric acid cycle is the oxidation of α-ketoglutarate to succinyl-CoA and CO2 along…
Q: Consider the differences between RNA and DNA. Which of the following statements are true? (This is a…
A: There are four classes of biological macromolecules: nucleic acids, proteins, lipids and…
Q: Sarin is an inhibitor of acetylcholinesterase. Draw a mechanism that shows this.
A: Before going into the mechanism by which sarin inhibits acetylcholinesterase, we need to know a bit…
Q: Give the names of both non-polar amino acids shown in the image Complex I is Comples It is I COO- T…
A: There are four types of biological macromolecules: nucleic acids, proteins, lipids and…
Q: As discussed in Lipids 3, SREBPs are a type of transcription factor involved in lipid homeostasis.…
A: The full form of SREBPs is Sterol regulatory element binding proteinsSREBPsare composed of two…
Q: Gerhart and Pardee measured ATCase activity in the presence of a variety of purine and pyrimidine…
A: Aspartate Transcarbamylase is an enzyme which regulate early step in synthesis of pyramidine…
Q: The urea cycle can be summarized through the following reaction: O COO- || H₂N-C-OPO3 +…
A:
Q: Briefly explain the advances in glucose monitoring techniques over the past sixty years.
A: The glucose monitoring techniques refers to the procedures and equipment used to monitor blood…
Q: D-galactose (Figure 2) reacts with methanol. Edit the structure of D-galactose drawn below to create…
A: Carbohydrates such as monosaccharides reacts with methanol in the presence of an acid to form acetal…
Q: Phosphofructokinase (PFK) activity is altered by changes in the energy state of the cell. Under high…
A: Phosphofructokinase (PFK) is an enzyme of the glycolytic pathway. Glycolysis is a catabolic pathway…
Q: isoprenoid precursors
A: Question A asks which isoprenoid precursor, IPP or DMAPP, is more susceptible to SN1 reaction. DMAPP…
Q: Why is malonate not a substrate for succinate dehydrogenase? Malonate has two carboxylic acid…
A: The reaction catalyzed by succinate dehydrogenase is given below.Succinate + FAD Fumarate + FADH2In…
Q: The enzyme aldolase catalyzes the reaction shown in the glycolytic pathway: Aldolase Fructose…
A: The ratio of concentration of products to reactants for any reaction in a given condition at…
Q: Oxygen is mainly carried through blood in what form?
A: Oxygen is essential for ATP generation through oxidative phosphorylation, and therefore must be…
Q: 1. What type of reaction occurred when the samples (enumerated) reacted with the Molisch reagent?…
A: As per Bartelby guidelines, an expert cannot answer more than one question. Kindly submit other…
Q: A patient has a defective liver FBPase-2 enzyme, the enzyme that converts F2,6P into F6P. This…
A: Fructose 2,6-BIsphosphate is a potent regulator of glycolysis and gluconeogenesis. It has a special…
Q: The pharmaceutical applications of the compound shown HO OH OH OH OH O A. Chemical substrate for…
A: Sorbitol less commonly known as glucitol.It is a sugar alcohol with a sweet taste which the human…
Q: Electron transfer translocates protons from the mitochondrial matrix to the external medium,…
A: Oxidation of substrates such as glucose, citrate, pyruvate etc releases electrons that are carried…
Q: Velocity, activity units/mg protein 51 3 2 0 5 15 20 Aspartate concentration, mM - 10 Control With…
A: Enzymes that are under allosteric control can be categorized into two groups;K-series enzymes :…
Q: concentration of hemoglobin in the system not bound resting tissues bound increase concentration of…
A: Transport of oxygen in blood depends upon hemoglobin. Basically hemoglobin has 4 subunits, 2 alpha…
Q: In hepatocytes, glucagon signaling leads to release of select one, which leads to the activation of…
A: Hepatocytes are responsible for regulating blood glucose level. When the blood glucose level…
Q: Draw one triacylglycerol with tails of fatty acids derived from the following three fatty acids:…
A: There are four classes of biological macromolecules; nucleic acid, proteins, lipids and…
Step by step
Solved in 3 steps
- 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C- Addin X O Informational Rese X E credible source act X Y Muhammad | Biogr X W Muhammad - Brita X mi.instructure.com/courses/25527/assignments/4743473 Due Wednesday by 11:59pm Points 100 Submitting an external tool Your progress has been saved Question 1 of 9 Which of the following statements are true about DNA polymerase? Select all that apply. O On the leading strand, it works toward the replication fork. O It adds nucleotides from the 5' end of the DNA toward the 3' end. O On the lagging strand, it works away from the replication fork. O It starts replication at one end and then switches sides and continues on to the other strand. « Previous-66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.Origin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] Guanineto 4 minutes) The schematic diagram below shows organization of the DNA replication fork. Match parts of the diagram (labeled A-F) with the corresponding term from the answer list (designated 31 parental duplex 5' 3' fork progression v A 1Lagging strand 2. An Okazaki tragment 3.Site of action of DNA topoisomerase 4 Leading strand 5. Site of action of DNA helicCase 6.Site of action of DNA ligase
- Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing method. You then separate the products of the reactions by gel electrophoresis and obtain the following pattern. What is the sequence of the template and the DNA on the gel? ddATP ddTTP ddCTP ddGTP Template V [ Choose 3'-CTAGTCAAGG-5' 5'-CTAGTCAAGG-3' Sequence 3'-GATCAGTTCC-5' 5'-GATCAGTTCC-3' 5'-GGAACTGATC-3'
- DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?Page 1 of 3 ZOOM DNA Replication_Protein Synthesis_Mutation Assignment *Please type your answers. 1. DNA synthesis and protein synthesis are two processes that are necessary for the cell. Why are these two processes necessary for the cell? How are they connected to each other? wious 4+ 1445’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer