Q: Search for the `P06858` a) Give information about the PTM and Processing of
A: triglyceride metabolism. Catalyzes the hydrolysis of triglycerides from circulating chylomicrons and…
Q: You are a USDA official and mustdecide whether to allow the planting of a new geneticallymodified…
A: The following questions should be asked to the scientists: - Is it safe for long term consumption…
Q: Why are the testes located outside of the body of organisms?
A: Testes is an organ that produces sperms. In human males, testes are oval in shape.
Q: 2 Cyt c 2 Cyt c IM Complex II
A: The electron transport chain is responsible for oxidizing the products of TCA cycle, pyruvate…
Q: The steps to assessing each parameter listed (for animals): - Respiratory rate - MM (Mucous…
A: The objective of the physical assessment is to determine the overall fitness level based on general…
Q: What factors make for an effective biological controlstrategy of pest management? What risks are…
A: Factors making effective biological control strategy of pest management:- Narrow target host range…
Q: Which checkpoints ensure that growth factors are available and check whether DNA replication in S…
A: Cell checkpoint checks error in the cell cycle progression.
Q: what conditions do bacteria need to grow ? think about the condition needed for yeast and if these…
A: Bacteria are prokaryotic organisms devoid of nucleus and membrane bound organelles.
Q: In which direction along the template must theRNA polymerase in Figure Q6–1 be moving to have…
A: Throughout transcription, the RNA polymerase proceeds along the template strand in a 5'-3'…
Q: Draw a schematic representation of Kreb’s Cycle. Label all the major steps and enzymes
A: Krebs Cycle is the intermediate part of cell respiration, that performed after that glycolysis and…
Q: The aerobic breakdown of glucose by bacterial cells yields ATP, while the anaerobic breakdown of…
A: The process that involves complete oxidation of respiratory substrate in presence of oxygen with…
Q: You are the head of an internationalgranting agency that assists farmers with soil conservationand…
A: Soil conversation is the prevention of loss of the top most layer of the soil from erosion or it can…
Q: Explain Nomenclature of neoplasia. provide examples
A: Neoplasia refers to the uncontrolled, abnormal growth of cells or tissues in the body; the abnormal…
Q: Explain the importance of soils to agriculture
A: Introduction The ecosystem can be defined as the interaction of living and non-living organisms…
Q: Evaluate the primary causes of biodiversity loss
A: Introduction :- Habitat loss, invasive species, overexploitation (excessive hunting and fishing…
Q: ) Human intervention
A: And the answer is option a.
Q: Develop a KEY to the CLASSES of Phylum ECHINODERMATA: Asteroidea, Ophiuroidea, Echinoidea,…
A: Asteroidea It is most well known echnioderms, also called sea stars They consist of thick arms…
Q: Specify the benefits that biodiversity brings us
A: Introduction :- Biodiversity refers to the diversity of life on Earth, or its biological diversity.…
Q: List the steps describing how the ATP synthase works to make ATP
A: ATP is the energy currency of cells. Mainly produce by the ATP synthase enzyme present on the inner…
Q: Compare and contrast substrate level and oxidative phosphorylation throughout cellular respiration.
A: Introduction cellular respiration is the process by which organisms mix oxygen with food molecules,…
Q: Describe the life cycle of a tapeworm.
A: Flat worms that can dwell in the intestines are known as tapeworms. Humans can contract these worms…
Q: Complete each sentence with the appropriate term or phrase. (Each box can be used only once, and not…
A:
Q: Question 4 Put the following events of neurulation in order, from first to last. Notochord signals…
A: Neuurulation is a process in which formation of neural plate, crest and groove occurs. This process…
Q: 1. Which of the following is true of steroid-based hormones (circle all that apply) (0.5) a. They…
A: Introduction A steroid hormone is a steroid that has hormone-like properties. Corticosteroids…
Q: Humans carry a variety of non-functional genetic sequences, called processed pseudogenes, in their…
A: Pseudogenes are non-functional genes that used to be functional one and they lack introns and has a…
Q: Which of the following hormones is not involved in the male reproductive system? O FSH O LH O…
A: Introduction :- The biological system of an organism's reproductive system, also known as the…
Q: 15. Describe the mechanism of RNA polymerase. What is the nucleophile? What is the leaving group?…
A: RNA polymerase is the main enzyme of transcription. Transcription is a process in which RNA is…
Q: During the cleavage stage of glycolysis, fructose-1, 6 biphosphate is ultimately broken down into…
A: The metabolic mechanism that transforms glucose to pyruvic acid is called glycolysis. The…
Q: Describe the types of cells in a sponge body, and explain howthey work together to keep the animal…
A: The thin body wall is derived only from two embryonic layers ectoderm and endoderm. A third Jelly…
Q: Question 9 What is the genetic code? O the genetic "words" that code for amino achas O all of our…
A: Cells decode mRNAs by reading their nucleotides in groups of three, called codons. Each codon…
Q: Describe how a sea star feeds.
A: Starfish, often known as sea stars, are echinoderms with a star-shaped body that belongs to the…
Q: Which protein transports oxygen in the bloodstream? O plasminogen O hemoglobin O erythropoietin O…
A: Option 2 is correct that is haemoglobin. Haemoglobin ( abbreviated as Hb or Hgb) is an iron…
Q: Serial dilution is recommended prior to pour and spread plate. Why is this so?
A: Pour Plate: it is a technique in which A plate made by combining the inoculum which is cooled but…
Q: Microtubules Intermediate Microfilaments filaments diameter shape Monomer(s) Rigidity Energy for…
A: Answer
Q: Hi, I know this is against the rules but I could use some help on the last two questions, please!…
A: Technology innovation has enabled the process of mass manufacture of things. Producing items on a…
Q: Rotenone is a broad-spectrum insecticide and that inhibits the electron transport chain. Why might…
A: Insecticides are chemicals that kill the insects that can cause disease while pesticides are those…
Q: In poodles black is dominant to white. A black poodle is crossed with a ehite poodle. In a litter of…
A: In genetics, crossing/ cross breeding refers to the intentional breeding of two different…
Q: As a field researcher interested in comparing communities in a stream habitat, what data will you…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: If I drink too much alcohol, then my ADH (antidiuretic and I will reabsorb ...,. hormone) levels…
A: Introduction - Vasopressin, also known as antidiuretic hormone, arginine vasopressin, or…
Q: 2. Draw out a labeled diagram explaining all the following processes: Gel Filtration Chromatography…
A: Introduction Biotechnology is the branch of science which deals with the application of biological…
Q: How do the different components like lipids, carbohydrates, and proteins exhibit the…
A: Cell membrane is selectively permeable (Semi-permeability- only let in some molecules inside the…
Q: B. cell wall, cell membrane, cytoplasm, nucleus C. cell membrane, chloroplast , nucleus, cytoplasm…
A: This question is about cell.
Q: A. Using a table, list properties of water and explanation for each property and state how this…
A: Water is a tasteless, colourless, odourless and transparent liquid used by almost every living…
Q: GQ#13: Why do systems of classification keep on changing? Do you see this as good or bad? Why do you…
A: Introduction The classification system is the establishment of a hierarchical system of categories…
Q: When microbiologists are working with bacterial batch cultures, we would expect to see no net change…
A: The most frequent laboratory growth method for studying bacterial growth is batch culture, however,…
Q: Provide an example of a molecule that cannot pass through the membrane? Can pass but with…
A: Cell membrane or plasma membrane is considered as semi permeable membrane because it allows certain…
Q: The transportation of carbon dioxide involves a reversible reaction involving the bicarbonate ion.…
A: Bicarbonate ion is involved in the carbon dioxide transportation :-
Q: At least five goals should be established for the Global Treps Project. Define each milestone using…
A: Introduction Goals are an important part of every aspect of business and life because they provide…
Q: A biologist is studying an organism that is single-celled. With only this information, we know that…
A: The living organisms are classified into different groups depending upon there characteristics. In…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 38.start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons. Second, start with two exons and show alternate 5’ splicing producing 1-2 and 1a-2 spliced exons. In one cell type, the 1a-2 isoform is more prevalent. Explain how SR protein binding to an ESE would regulate this preferred isoform. Be sure to include U1 in your response and define ESE.+1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? eGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
- 2b) What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?5. The following DNA nucleotides are found near the end of a bacterial transcription unit. 3-AGCATACAGCAGACCGTTGGTCTGAAAAAAAAGCATACA-5' Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form. a. b. Suppose that the string of A nucleotides following the inverted repeat in a rho-independent terminator were deleted but that the inverted repeat was left intact. How will this deletion affect termination? What will happen when RNA polymerase reaches this region?2. Define each of these processes that are essential to the formation of a protein. a. Transcription b. Translation translation is the process of generating polypeptide using the information carried on an MRNA molecule. 3. Complete the table to summarize each process Process Template Product Synthesized Location in Eukaryotic Cell Transcription Translation 4. Write the central dogma of molecular genetics, as proclaimed by Francis Crick? 5. How many nucleotide bases are there? 6. How many amino acids? (Hint: look at page 77 of your book) 7. DNA is double stranded, but for each protein, only one of these two strands is used to produce an MRNA transcript. What is the strand called? 8. Here is a short DNA template. Below it, assemble the complementary MRNA strand. Recall that DNA-DNA, DNA-RNA, and RNA-RNA strand interactions are antiparallel. This means Vour MRNA strand will run 5' to 3'
- 20 of 22 If a strand of MRNA has the sequence 5'-CUGUCA...ACUC-3' (with […] representing the intervening sequence), what was the template strand of DNA used to produce this mRNA? 3'-GACAGU...UGAG-5' 5'-CTGTCA...ACTC-3' 5'-CUGUCA...ACUC-3' 3'-CTGTCA...ACTC-5' 3'-GACAGT...TGAG-5'www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcriptionYou continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
- 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense suppressor?d. What are the amino acids most likely to be carriedby this suppressing tRNA?46What is the A-site of the ribosome? A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site 47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48Pre-mRNA requires specific sequences for precise __________ to occur. A.splicingb.taggingc.replicationD.skipping