Question 11 (Population/Quantitative Genetics) A (dominant) and a (recessive) are alleles whose respective frequencies are p and q in a given interbreeding population at equilibrium. If 9 percent of the individuals in the population have recessive phenotypes, what is the percentage of heterozygous genotypes? 0.9% O 70% 42% O 91%
Q: Which of the following would result in offspring MOST genetically similar to its parent? a whiptail…
A: The correct answer is (d) an aphid arising from asexual reproduction. Asexual reproduction involves…
Q: Miya fell in the playground and a splinter got stuck in her arm. Describe in your own words and in…
A: Introduction The immune system is a complex network of cells, tissues, organs, and molecules that…
Q: How is ATP produced in chloroplasts?
A: Introduction Chloroplasts are organelles found in plant cells and some other eukaryotic organisms,…
Q: Label 10 structures of the dermis.
A: Introduction: Dermis is the inner layer of 2 major layers of skin. It supports and protects the…
Q: Pharmacogenetics is the study of the effects of genetic factors on drug responses in patients.…
A: The study of how drugs interact with the body at the molecular and cellular levels is known as…
Q: 3. Name and describe the five steps of viral replication. Which step or steps differ the most…
A: Introduction :- Replication refers to the process of making a copy or a duplicate of something, such…
Q: Identify which derived characters were homologies or analogies in denote species
A: Homologous characters are those characters of different organisms which are derived or inherited…
Q: Is bone marrow a type of tissue? Is cartilage a type of tissue?
A: Introduction A collection of like cells that collectively carry out a particular task for the body…
Q: Can natural assimilation reduce eutrophication? Is there a limit to natural assimilation? Discuss.
A: Natural Assimilation: Natural assimilation refers to the process by which living organisms…
Q: 10. Which type of placentation is found in dogs and cats? O A. Discoid O B. Diffuse O C.…
A: Introduction The term "placentation" describes the development and structure of the placenta, an…
Q: In what way are the structures of mitochondria and chloroplasts similar and different? What…
A: Introduction: ll organelles are specialized structures within eukaryotic cells that have specific…
Q: The representation must be on a linear scale (not logarithmic) . Have the student to present the…
A: The assignment given here is related to the timeline of the various evolutionary events that…
Q: Please provide answer to the other problem asked: Diagnostic Key Characteristics for Genus ID using…
A: Cyanobacteria are considered Gram Negative bacteria which are able to perform photosynthesis due to…
Q: In rodent development, what would happen if there was no x-fetoprotein to bind the circulating…
A: Introduction Alpha-fetoprotein (AFP) is a protein that is normally produced during fetal…
Q: Match the degree of a burn with its symptoms: 4th hypodermic layer; skin white or black 3rd bones…
A: Introduction An damage to the skin and underlying tissues known as a burn can be brought on by…
Q: Which brain nucleus is larger in female rats compared to male rats? a) Anteroventral periventricular…
A: SDN-POA, is typically larger in male rats than in female rats. SNB is a region in the midbrain that…
Q: If a Drosophila is found to have axons that cross back and forth over the body's midline several…
A: Introduction Drosophila, commonly known as fruit flies, is a genus of small flies belonging to the…
Q: A five-year-old child is brought to the pediatrician's office with a concern that the child is not…
A: Shortened extremities suggest that the bones are not growing as they should, and the fact that the…
Q: The delivery of blood by the left ventricle into the sorta is intermittent, whereas blood flow in…
A: Peripheral circulation refers to blood flow in smaller blood vessels such as arterioles and…
Q: Chemical and physical properties of gases are important factors in the evolution and physiology of…
A: A complicated system that consists of the heart and lungs, blood arteries, and blood is the…
Q: Draw a cladogram of the 3 Classes of Platyhelminthes and add 1 outlier from another Phylum. Make…
A: The phylum Platyhelminthes includes three classes: Turbellaria, Trematoda, and Cestoda. Turbellaria…
Q: Hookworms, parasitic nematodes transmitted through contact between bare feet and soil, infect nearly…
A: 3 a) As the hookworm is nematode parasite , to find the FST between these two given population that…
Q: Water Body Y DO sample (0) DO blank (0) DO sample (5) DO Blank (5) Titration volume (ml) 3.Calculate…
A: To calculate the concentration of BOD in water body Y, we can use the following formula: BOD = [(DO…
Q: Read through the passage below and answer the questions that follow: X is a zoonotic infection…
A: The detection of viral infections requires a combination of clinical observation, laboratory…
Q: A hormone epinephrine binds to G-protein coupled receptor and activate multiple signaling pathways…
A: Introduction :- Epinephrine, also known as adrenaline, is a hormone and neurotransmitter that is…
Q: 4. Which of the following mutations would be silent, missense, nonsense, or frameshift? The original…
A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur due to…
Q: What is the pH of an aqueous solution of 7.37x10-2 M potassium hydroxide? PH =
A: Introduction A solution's pH value indicates how basic or acidic it is. It is based on the quantity…
Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…
A: Genes are hereditary structures on genetic material. These control some specific particular traits.…
Q: Muscle contraction is the biomechanical process of: Ostretching elastic elements to produce force…
A: Introduction Muscle contraction is a physiological process that involves the activation of muscle…
Q: When a neuron reaches threshold voltage, all voltage-gated channels are triggered to make…
A: Neurons are specialized cells that transmit information in the nervous system. When a neuron…
Q: Sliding-clamp proteins load polymerase onto the primer and maintain its stable association with the…
A: Answer 1) True. Sliding-clamp proteins, like the proliferating cell nuclear antigen (PCNA) in…
Q: 2. Organism Oxygen Requirements Clostridium sporogenes C.S. Obligate Anaerobes Pseudomonas…
A: An organism is needed oxygen for growth, especially for respiration to a breakdown of food, in the…
Q: You are given the biochemical pathway below. Seven mutant strains (labeled S1-S7) are defective in…
A: The answer of this question will be option c, None of these.
Q: How to plants respond to hot, arid conditions? Plants close their stomata to prevent a loss of…
A: INTRODUCTION Stomata It is pores present on the epidermis of leaf, stem and other organs and it…
Q: To what features of the visual world do simple and complex cells of the mammalian visual cortex…
A: The visual cortex is part of the brain that processes visual information from the eyes. It is found…
Q: An aqueous plant found in its natural environment would be in a solution known as: a. Hypotonic b.…
A: Introduction Tonicity refers to the effect of a solution on the movement of water across a…
Q: Which of the following factors does not directly affect cardiac output? the volume of blood ejected…
A: Cardiac Output: Cardiac output (CO) is the amount of blood that the heart pumps out per minute. It…
Q: What are the roles of membrane fluidity in neuron function? What are the roles of conformational…
A: Introduction Membranes are thin layers of lipid molecules that help to form the boundaries of cells…
Q: Which of the following is LEAST likely to be expressed in a corpus luteum? progesterone receptors…
A: The ovaries produce egg in each mensural cycle. After the egg is released in the fallopian tube, the…
Q: What are the major acute and chronic physiological effects of cannabis on the body?
A: Cannabis, also known as marijuana, has physiological effects on the body that are both acute and…
Q: Once an action potential reaches a neurotransmitter release site, the release of the…
A: When an action potential reaches the end of an axon terminal, it triggers the opening of…
Q: Give typed explanation What pattern of evolution results when selection favors a rare recessive…
A: Introduction : In genetics, a recessive trait refers to a particular characteristic or phenotype…
Q: an you please annotate the two images attached. Also send a picture of the parts where you…
A: Annotation for figure 1
Q: What is an effect of alcohol consumption in relation to hormones? O the osmoregulator cells of the…
A: A hormone is a chemical messenger secreted by an endocrine gland or specialized cells that travels…
Q: Conduction velocity refers to the [a] at which an action potential travels along a neuron's axon. In…
A: Neurons are specialized cells in the nervous system that transmit electrical and chemical signals…
Q: The following conditions are given below in leukocyte counting. Will it be increased or decreased?…
A: The following conditions are given below in leukocyte counting, and whether they would cause an…
Q: Match the definitions and key words with the group name (programmed or stochastic). From the drop…
A: 1. The cellular aging theory suggests that the lifespan of a species is limited by an internal…
Q: Blood is taken from a snake with a plasma osmolarity of 300 mOsM. The cells are purified and…
A: Plasma osmolarity is a measure of the concentration of solutes in the plasma of blood, and is…
Q: Name one way other that a protein synthesized in the cytosol might then be targeted to the plasma…
A: Introduction: The cytosol, also known as the cytoplasmic matrix, is the fluid that fills the cell…
Q: A marine ray (a euryhaline, osmoconforming, ionoregulator) moves its way from seawater to…
A: Introduction A marine ray is a type of cartilaginous fish that belongs to the family of rays, which…
Give typing answer with explanation and conclusion
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Change in allele frequency of a population is called ______ . a. macroevolution b. adaptive radiation c. inbreeding d. microevolution@ 2 W S Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a flat, warm habitat. Their fur texture and color ranges from thick purple fur to thin pink fur, depending on allele distribution. The dominant fur allele (R) codes for thick purple fur. The recessive allele (r) codes for thin pink fur. REMEMBER: a phenotype (fur color) is the physical expression of a genotype (two- letter code for the alleles present in that individual). Each individual has two alleles for fur color: X RR genotype is homozygous dominant = Thick purple fur phenotype Rr genotype is heterozygous = Thick purple fur (because of the presence of one dominant allele) rr genotype is homozygous recessive = Thin pink fur (because of the absence of a dominant allele) For the purposes of this experiment, Rehpogs mate once per year and produce two offspring each year. Rehpogs are monogamous, faithful and fertile. # 3 e d C C $ 4 r f V % 5 t g Oll 6 b y h & 7 O 8 n JL u i j O L m…Тext 7. If 96 out of 200 individuals in a population express the recessive phenotype, what percent of the population are heterozygotes? 40% 8. A hypothetical population of 100,000 humans has 68,240 individuals with the blood type AA, 28,735 individuals with blood type AB and 3025 individuals with the blood type BB. a. What is the frequency of each genotype in this population? b. What is the frequency of the A allele? c. What is the frequency B allele? d. If the next generation contained 250,000 individuals, how many individuals would have blood type BB, assuming the population is in Hardy-Weinberg equilibrium?
- Amath 423 Homework #1.04 Blood Work Consider the following, hypothetical data for the genotypic frequen- cies associated with the A, B, AB, and O blood groups in a population: Genotype 14i Bi ii Frequency 0.1 0.3 0.1 0.1 0.1 0.3 (a) What will the genotypic frequencies be in the next generation, assum- ing random mating ? (b) At Hardy-Weinberg equilibrium, what is the probability that two per- sons, chosen at random, are of the same blood group ?Bikini Bottom Genetics Name Selentists at Bikini Bottoms have been investigating the genetic makeup of the organisms in this community. Use the Information provided and your knowledge of genetics to answer each question. 1. For each genotype below, indicate whether it is a heterozygous (He) OR homozygous (Ho). Ff bb TT- DD Bb dd Dd ff Tt BB. FF Which of the genotypes in #1 would be considered purebred? Which of the genotypes in #1 would be hybrids?. 2. Determine the phenotype for each genotype using the information provided about SpongeBob. Yellow body color is dominant to blue. Y, Yy yy Square shape is dominant to round. 3. For each phenotype, give the genotypes that are possible for Patrick. A tall head (T) is dominant to short (). Tall= Pink body color (P) is dominant to yellow (p). Short = Pink body =, Yellow body = 4. SpongeBob SquarePants recently met SpongeSusie Roundpants at a dance. SpongeBob is heterozygous for his square shape, but SpongeSusie is round. Create a Punnett…?action=Donresume&submissionld%3D459115049 Trait Dominant Allele Recessive Allele Body Color Brown (B) Albino (b) Back Stripe No Stripe(N) Stripe (n) Fill in the blanks (1-4) in the Punnett square below and answer the questions. Bn Bn Bn Bn bN BbNn BbNn BbNn bn Bbnn Bbnn Bbnn bN BbNn BbNn BbNn bn Bbnn Bbnn Bbnn For the next two questions below, fill in the allele(s) that you are looking for to determine the number of each type of traits specified. (HINT: Remember how many alleles do you need to have the dominant trait vs the recessive trait) How many gecko offspring will be brown and have a stripe? How many gecko offspring will be albino and have no stripe? What is the phenotype of the genotype BbNn? : B :: b :: N : BB :: Bb :: bb :: NN : Nn :: nn :: Brown and no stripe : Brown and a stripe : Albino and no stripe : Albino and a stripe : 0 :: 4 :: 6 :: 9 :: 8 : 12 :: 16 : BBNN :: BBNN : BBnn :: BBNN : BBN. : Bbnn : bbNN : bbNn :: bbnn
- 700 peak 1 600 500 400 300 200 3- 100 Peak 6 - Stripes Peak 7 Peak 5 Spur Length Petal Tips Peak 4 -Anthers Stigmas Blade Color Spur Color - Petal Color Peak 2 Peak 31 in 1700 US Caucasian newborns has cystic fibrosis, which is only present in individuals with the homozygous recessive genotype. Assuming the population is in Hardy Weinberg equilibrium, what is the allele frequency of the dominant allele in the population.PDE Mendelian Genetics Fall20.pdf Observational Science Home Lab x + O File | C:/Users/Emera/Desktop/Mendelian%20Genetics%20Fall20.pdf Not syncing of 8 A' Read aloud | V Draw E Highlight O Erase 4 Cystic fibrosis is a fatal genetic disease that affects one child in 1,600. It is an autosomal recessive gene. Both parents are heterozygous for this trait. A10) What are the phenotypes of each parent? A11) In terms of alleles, what are the different gametes each parent can produce? A12) This couple has had three children without cystic fibrosis. If the couple has a fourth child, what is the probability that it will have the disorder? In humans, the dominant allele 'D' codes for deafness, and the recessive allele 'd' codes for normal hearing. The father is homozygous recessive and the mother is heterozygous. A13) Construct a Punnett square. A14) What is the phenotypic ratio of their offspring? What is the genotypic ratio of their offspring? Part B: Dihybrid Crosses What would result from a…
- 14. In class we explored how genotype frequencies can change between generations. In our experiment, we started with a population in which every individual was heterozygous for a few traits of interest. The data for the 11 offspring of these heterozygotes are below. Make sure you show at least some work for partial credit. Frecueles Eje coloN Freckles Genotype FF Eye Shape Genotype EE Eye Color Genotype RR (P 3 (P 3 Ff 5 Ee .0.3 1-0.3 3 RB 7 ff 1 ее Phenotypes Freckles No freckles Phenotypes Phenotypes Red |-0.3 FF, Ff Circle EE, Ee RR Ro.HFF) ff Star ее Purple Blue RB or BR 20.42 BB a) What were the initial allele frequencies for freckles in the starting population? FF=0.42 b) What percentage of the starting population had purple eyes? c) What are the allele frequencies for freckles after one generation? (FF)P= 0.7 (FN 2pf=0.42 (fF) = 03 d) What percentage of the population had purple eyes after one generation? e) Are the genotype frequencies for eye shape what you would expect based…ocesses/Se are the same se two trees are NOT the same At some point in the past, foxes arrived in the Arctic (far northern latitudes) and we able to establish a population. Now, there is a white population of foxes that lives there. Which of the following was the primary change that occurred gradually over time in the Arctic fox population, eventually resulting in foxes with white fur? O The fur color of each individual fox within the population gradually changed. O The frequencies of foxes with different fur colors within the population changed. O Mutations occurred to meet the need of the fox population in the new environment. O Foxes that survived longest gained white fur in their old age, which they passed on to their offspring, tion 151₁ F3 8 A = all of the dominant alleles for a particular trait in a specific population; a = all of the recessive alleles for a particular trait in a specific population In the following equations "A" is represented by "p" "a" is represented by "q" Hardy Weinberg equations: Allele distributions in Generation 1: 36 homozygous dominant individuals 13 heterozygous individuals 1 homozygous recessive individual Explanation of terminology: px p=p² There are 50 individuals in this particular population. We want to see if allele distributions change from generation to generation. We will use the Hardy Weinberg equations to find out. Due to migration and random mating of the parent generation, the percentage of homozygous recessive genotypes in Generation 2 offspring increases, changing_"a" to 40%, so a = 40 If "a" = .40, and "a"=q, then q = $ Remember that p + q = 1.0 If q, then p must = How many of these 50 offspring are homozygous dominant, heterozygous, or homozygous recessive? p² + 2pq+q²=…