Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA CAGGAAAAAATTATTCCCTAG This gene begins with a start codon (ATG) and ends in a stop codon (TAG). 1. What is the amino acid sequence of the protein that is encoded by this gene? 2. Using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (free tool), try to determine the identity of this protein based on its amino acid sequence. What is the full name of the top hit identified using this tool? 3. What are the Identities, Positives, and Gaps values for the alignment between the protein encoded by this gene and the top hit that you identified using a bioinformatic tool? Briefly explain what these values mean, referring specifically to the amino acid sequence of the protein encoded by this resistance gene and the amino acid sequence of the top hit identified in the online database. That is, what are the specific differences between the two amino acid sequences that explain the Identities, Positives, and Gaps values?
Molecular Techniques
Molecular techniques are methods employed in molecular biology, genetics, biochemistry, and biophysics to manipulate and analyze nucleic acids (deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)), protein, and lipids. Techniques in molecular biology are employed to investigate the molecular basis for biological activity. These techniques are used to analyze cellular properties, structures, and chemical reactions, with a focus on how certain molecules regulate cellular reactions and growth.
DNA Fingerprinting and Gel Electrophoresis
The genetic makeup of living organisms is shown by a technique known as DNA fingerprinting. The difference is the satellite region of DNA is shown by this process. Alex Jeffreys has invented the process of DNA fingerprinting in 1985. Any biological samples such as blood, hair, saliva, semen can be used for DNA fingerprinting. DNA fingerprinting is also known as DNA profiling or molecular fingerprinting.
Molecular Markers
A known DNA sequence or gene sequence is present on a chromosome, and it is associated with a specific trait or character. It is mainly used as a genetic marker of the molecular marker. The first genetic map was done in a fruit fly, using genes as the first marker. In two categories, molecular markers are classified, classical marker and a DNA marker. A molecular marker is also known as a genetic marker.
DNA Sequencing
The most important feature of DNA (deoxyribonucleic acid) molecules are nucleotide sequences and the identification of genes and their activities. This the reason why scientists have been working to determine the sequences of pieces of DNA covered under the genomic field. The primary objective of the Human Genome Project was to determine the nucleotide sequence of the entire human nuclear genome. DNA sequencing selectively eliminates the introns leading to only exome sequencing that allows proteins coding.
Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer.
A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing.
Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance:
> putative antibiotic resistance gene
ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT
ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT
TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG
CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA
CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC
AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC
CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG
AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG
CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG
AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG
GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG
GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG
TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG
CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA
TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT
GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG
GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA
CAGGAAAAAATTATTCCCTAG
This gene begins with a start codon (ATG) and ends in a stop codon (TAG).
1. What is the amino acid sequence of the protein that is encoded by this gene?
2. Using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (free tool), try to determine the identity of this protein based on its amino acid sequence. What is the full name of the top hit identified using this tool?
3. What are the Identities, Positives, and Gaps values for the alignment between the protein encoded by this gene and the top hit that you identified using a bioinformatic tool? Briefly explain what these values mean, referring specifically to the amino acid sequence of the protein encoded by this resistance gene and the amino acid sequence of the top hit identified in the online database. That is, what are the specific differences between the two amino acid sequences that explain the Identities, Positives, and Gaps values?
Step by step
Solved in 5 steps with 2 images
