Liver NADH increases gluconeogenesis. How do you interpret this?
Q: Question 37 The following peptides were measured for a longer sequence that you are interested in…
A: The proteins are composed of twenty naturally occurring amino acids. According to Anfinsen's…
Q: Explain the role of carnitine in the energy supply of the myocardium
A: Carnitine plays an important in heart's metabolism. It's responsible for transporting fatty acids,…
Q: Question 7 Consider the structure of Baclofen, a GABA derivative used to treat cerebral palsy, drawn…
A: Baclofen is a chlorophenyl derivative of gamma-aminobutyric acid (GABA) derivative and it is a…
Q: If a specimen contains 30% adenine in its DNA, how much cytosine will it contain? O 40% O 30% O 20%…
A: The biological macromolecule DNA that contains the genetic information responsible for the…
Q: 1. Which of the following statement is correct? a. Lipids can only participate in the TCA cycle. b.…
A: Metabolism of biomolecules is a interrelated process. The end product of one metabolic pathway can…
Q: 3. A student in my lab was trying to express the cytosolic (not membrane bound) enzyme PseG and…
A: The expression of proteins in a prokaryotic or eukaryotic cell involves transcription and…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: TRUE OR FALSE? Buffering capacity continuously decreases as acids and bases are continuously added,…
A: Introduction pH is defined as the negative logarithm of H+ concentration of a solution. pH meter is…
Q: Formation of cholesterol "fund" in the liver.
A: Cholesterol contains 27 carbon atoms all supplied by acetyl CoA. Cholesterol has 3 six-membered…
Q: For the reaction 4 A + 5 B → 2C+ 3 D, what is the magnitude of the rate of change for [D] when [A]…
A: According to law of chemical kinetics, the rate of product formation is directly proportional to the…
Q: Explain the difference between ΔG°’ and ΔG and calculate the free energy (delta G) of hydrolysis of…
A: In chemical and especially biochemical systems (like cells), we are concerned more about the energy…
Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 10 glucose molecules are used in anaerobic respiration. How many ATP will be yielded under these…
A: Cellular respiration occurring when oxygen is absent is known as anaerobic respiration. It is a…
Q: 1. Biochemical mechanisms of fatty acids and glycerol mobilization. 2. Metabolism of glycerol,…
A: Triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are linked to one…
Q: Refute or support the statement: “Photosynthesis and oxidative phosphorylation are essentially the…
A: Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to produce…
Q: Give the molecular and structural formulae for: –2 examples of structural isomers of monosaccharides…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Consider the reaction below. Where would the labelled carbon (represented by the asterisk * in the…
A: As you can see the reactant side is undergoing the reaction where there is removal of CO2 and NADP+…
Q: 23. Which is a general term indicating a carbohydrate polymer? A) Glycan B) Polycarb C) Multimer D)…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Prepare a schematic diagram and present it. The Figure should illustrate the interactions made…
A: Binding of drug to receptor or protein can be specific and non-specific. For the genuity of the…
Q: 1.a)Which statement is correct with respect to eggs? The white of an egg has about equal quantities…
A: Proteins are complex macromolecules that play a central role in the structure and function of all…
Q: In a case where the energy source to be used it 1 malate unit, exactly how many ATP can be yielded?…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP from oxidation of…
Q: Create a concept map connecting cancer and pyruvate kinase m2
A: Pyruvate kinase plays a very important role in cell metabolism. It catalyses the rate limiting step…
Q: A diet deficient in folic acid is highly unlikely since folic acid is found in almost all foods.…
A: A diet deficient in folic acid can have serious health consequences. Folic acid, also known as…
Q: 1. Fill in the table below. In the first 2 columns, specify what you are comparing and contrasting…
A: Oxidative phosphorylation is the metabolic pathway of ATP production utilizing enzymes with the…
Q: Identify different types of organic reaction mechanism (SN1, SN2, etc) and reaction types (addition,…
A: SN1 reactions are substitution nucleophilic reactions that occur in a single step. They involve the…
Q: Lipids affect your health? why or why not
A: Lipids include fats, oils, waxes, and certain types of steroids. They are an essential component of…
Q: Certain proteins undergo Post Translational Modifications (PTMs) with lipid derivatives such as…
A: Post-translational modification Post-translational modification is a process by which proteins are…
Q: 5. Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: For a reaction to proceed spontaneously the change in Gibbs free energy (∆G) of the reaction has to…
Q: If you want to make 7 L of 1X TGS (Tris/Glycine/SDS Running Buffer) using 8 x TGS stock, how much of…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: Production of a recombinant protein by E. coli is proportional to cell growth. Ammonia is used as a…
A: Recombinant proteins are proteins that are produced through genetic engineering. They are created by…
Q: Fill in the table below. In the first 2 columns, specify what you are comparing and contrasting in…
A: Introduction Oxidative phosphorylation is a cellular process by which the molecular oxygen reduced…
Q: A patient receives an intravenous (IV) solution that flows at the rate of 150 mL per hour. How…
A: The intravenous solution is the fluids or any medicine that is directly given into the vein. It…
Q: Shown below is the structure of Drug 1, that binds to the E. coli ribosome. Indicate whether each…
A: Since, you have asked multiple questions from multiple concepts, we have answered all 4 subparts of…
Q: In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene…
A: Molecular weight of the protein can be calculated by adding the molecular weight of the individual…
Q: You are studying COVID-19 which infects bat cells through an interaction between a lysine residue on…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: list the primary energy system out of these 3 (only pick 1) (TP-PC System, Glycolysis & Citric Acid…
A: Food is the composition of carbohydrates, fats and proteins. On digestion these macromolecules are…
Q: A cyanobacterium absorbs 2856 photons. How many molecules of ATP are produced?
A: The process of ATP synthesis in cyanobacteria occurs through the process of photosynthesis,…
Q: Write schematically the synthesis of phosphatidylethanolamine through the activation of amino…
A: INTRODUCTION : Phospholipids : They are a group of biochemical compounds which are made up of fatty…
Q: What is the effect on the biosynthetic pathways if the oxidative branch of a person’s pentose…
A: The pentose phosphate pathway (PPP) is an alternate pathway to metabolize Glucose 6-phosphate…
Q: When the enzyme is incubated with iodoacetate, it is observed that glyceraldehyde-3- phosphate still…
A: Enzymes are made up of amino acids, and the sequence as well as the arrangement of those amino acids…
Q: 3. Some proteins are membrane bound and have segments (called transmembrane domains) that pass…
A: There are different proteins associated with lipid bilayer and they perform different functions.…
Q: Plant cell walls are made out of ___ Select one: a. a polymer, cellulose b. a three carbon molecule,…
A: Cell walls that surround plant cells are primarily made of complex polysaccharides.
Q: Enzymes are essential to the processes of photosynthesis and cellular respiration. Names two factors…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Explain this krebs cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: You want to maintain pH-7.0 for an enzyme-catalyzed reaction that will produce hydrogen ions along…
A: Here we are undertaking a reaction that will produce hydrogen ions (H+, generally termed as protons)…
Q: In the folded protein, His108 forms a salt bridge with Asp44. The pKa of the imidazole functional…
A: pKa is the pH at which a weak acid is 50% dissociated into H+ and conjugate base. Also, pKa = -log…
Q: Discuss how the cell uses RNA molecules to synthesize proteins.
A: The majority of living things and viruses include the molecule known as ribonucleic acid (RNA). It…
Q: Question 3 A 50 kDa protein has a minimum radius 2.4nm, while a 20 kDa protein has a minimum radius…
A: 3 Answer the NPC would not allow proteins with a radius >2.5 nm to pass through freely,…
Q: What is the x-intercept for the above reaction on a Lineweaver-Burk plot? A. -0.5 per mM B. -1.0 per…
A: The Michaelis Menten equation: vo = vmax × [S]Km + [S] where vo is the initial rate of the…
Liver NADH increases gluconeogenesis. How do you interpret this?
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Increased levels of NADH in the liver promote the process of gluconeogenesis. What do you make of this statement?Glucose can be made from oxaloacetate during gluconeogenesis, but if oxaloacetate concentrations are decreased,what other substance can be used to make glucose? How might this contribute to increased fat loss?Elevated liver NADH levels favors gluconeogenesis.Explain this statement.
- Elevated liver NADH levels favours gluconeogenesis. Explain this statement.NADH boosts gluconeogenesis in the liver. So, what do you think about this assertion?(a) Briefly describe the relationship between intracellular malonyl- CoA levels in the liver and the control of ketogenesis. (b) Describe how the action of glucokinase helps the liver to buffer the level of blood ghucose.
- Is ketogenesis anabolic or catabolic? Thus, what initiates the ketogenesis in our body?(a) Briefly describe the relationship between intracellular malonyl-CoA levels in the liver and the control of ketogenesis. (b) Describe how the action of hexokinase IV helps the liver to buffer the level of blood glucose.What is the effect of insulin on the committed step of glycolysis in the liver? Describe the mechanism by which insulin can affect the activity of this enzyme in the liver?
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)