You want to maintain pH-7.0 for an enzyme-catalyzed reaction that will produce hydrogen ions along with the desired product. At equal concentrations, which weak acid, if any, will serve as the better buffer for the reaction: acid A, with pk-6.5, or acid B, with pk-7.5?
Q: In the following polypeptide, which amino acid would be participating in hydrogen bonding with…
A: Alpha helix is one of the most prominent secondary structures formed by polypeptide chains. The…
Q: Formation of cholesterol "fund" in the liver.
A: Cholesterol contains 27 carbon atoms all supplied by acetyl CoA. Cholesterol has 3 six-membered…
Q: Consider a peptide with the sequence Ala-Glu-Arg-Leu. Assume the ionizable groups have the pKa…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: 1.2 Ninhydrin Test Substance 2% glycine 2% gelatin 2% albumin 1% tyrosine casein + distilled water…
A: Ninhydrin test : It is the alpha-amino groups in proteins and amino acids that are responsible for…
Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…
A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: Part Three: Metabolism: Your cells are going to USE the food they've been provided! Describe the…
A: Metabolism is the chemical reactions occurs in our body which changes the food into energy to run…
Q: The number of calories used during physical exercise is greater than the number of calories used for…
A: Since you have posted multiple questions, we will provide the solutiononly to the first three…
Q: Name : Surname: 2. The amino acid side chain residues in an a helix point center of the helix. A)…
A: The proteins consist of 20 naturally occurring amino acids. The proteins must fold into the proper…
Q: A) Polymer Lipid DNA B) Monomer (or component units in the case of lipids). Draw the specific…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: a) Draw the 5’-monophosphate-2’-deoxyguanosine nucleotide covalently bonded with neighboring DNA…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: 1. Answer the following questions: a. A substance produced from pyruvate that is a precursor in the…
A: Glucose is the simplest carbohydrate, which is utilized as the primary source of energy. The complex…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: Transcription is the process of conversion of DNA to RNA, in this process the template strand is…
Q: A patient receives an intravenous (IV) solution that flows at the rate of 150 mL per hour. How…
A: The intravenous solution is the fluids or any medicine that is directly given into the vein. It…
Q: Mechanism of cholesterol excretion from the body
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: In the lactase enzyme simulation you conducted in Part 1 of this Nutrition Lab, you found that…
A: The following steps will explain how lactase acts on a mixture of coffee and milk in comparison to…
Q: What does it mean for an amino acid to be polar? Please explain what qualities about an amino acid…
A: Proteins are folded polypeptides. A polypeptide is a polymer of amino acid residues linked via a…
Q: What do vaccines introduce into the body? short chain fatty acids antibodies lymphocytes phagocytes…
A: vaccines are biological preparations that help to stimulate an individual's immune system to produce…
Q: 13. Fill in the blanks using the keywords. +2 NADH +NAD+2 2 coenzyme A MITOCHONDRIA + CO₂ Glycolysis…
A: Introduction Glycolysis is a first step of cellular respiration. Glycolysis consists of 10 steps. In…
Q: You take out a 35-year mortgage loan for $634000. The annual interest rate of the loan that you pay…
A: To calculate the number of payments required to pay off a loan, you need to use the formula: n =…
Q: DNA MELTING Two antiparallel single strands form a DNA duplex according to the following model: SA…
A: Gibbs's free energy, also known as free energy or G, is a thermodynamic quantity that represents the…
Q: You want to digest 1 µg of plasmid DNA in a final volume of 50 µL. Your solution containing plasmid…
A: A plasmid is an extrachromosomal DNA molecule within a cell that is distinct from chromosomal DNA…
Q: Consider the amino acid aspartic acid for this problem. Aspartic acid can be considered a triprotic…
A: Aspartic acid have 3 ionizable groups in it. They are; alpha- carboxyl group alpha-amino group…
Q: What are the two monosaccharides that make up this structure? H₂N НО CH3 OH OH H NH₂ N
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: How do you draw different amino acids at ph 7? can you show me an example which I can follow to draw…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain a carboxyl…
Q: Identify different types of organic reaction mechanism (SN1, SN2, etc) and reaction types (addition,…
A: SN1 reactions are substitution nucleophilic reactions that occur in a single step. They involve the…
Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…
A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…
Q: True and false - A k+ channel will be just as permeable to Na+ as to K+ because Na+ is a smaller ion…
A: Ion channels are proteins that form pores in the plasma membrane and allow ions to pass through in…
Q: Fill in the blank 1.) triaycerols form_____ rather than lipid bolsters 2.) the most abundant…
A: Triacylglycerols are fatty acid esters of glycerols, with 3 fatty acids (long hydrocarbon chain…
Q: Long chains of beta glucose monomers are held together in microfibril bundles by bonds Vanderwaals…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…
A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Answer 2 The Bose-Einstein Principle -Bose-Einstein condensate is a group of atoms cooled to within…
Q: 7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and…
A: Dilution results in a decrease in the concentration of a substance in a mixture. A stock solution is…
Q: Which pathways are utilized in order to allow for glucose from glycogen to be converted to ribose…
A: Glycogen is a storage polysaccharide made up of D-glucose residues. When signalled, the cell can…
Q: 5. Ways of cholesterol biotransformation, their tissue localization: 5.1. extracellular (LCAT) and…
A: Sterols are lipids with the characteristic steroid nucleus. The steroid nucleus is four fused rings,…
Q: 1. Calculate a creatinine clearance and its reference range. 2. Explain the biochemical formation…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Consider a hypothetical metabolic pathway involving four enzymes to convert molecule A into molecule…
A: Allosteric enzymes are enzymes whose catalytic activity is regulated by an effector molecule that…
Q: 9. Compartmentation in ß Oxidation Free palmitate is activated to its coenzyme A derivative…
A: Beta oxidation is the biochemical pathway by which fatty acids are broken down two carbon at a time…
Q: Draw two ringed a-D glucose monomers forming a disaccharide (maltose). Make sure to label the…
A: Glucose is a 6 carbon containing aldose sugar i.e. it is an aldohexose. The most stable ring form of…
Q: A 24-residue peptide called Pandinin 2, isolated from scorpion venom, was found to have both…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 2. A mutation that changes an alanine residue in the interior of a protein to valine (A157 → V157)…
A: Different protein gain its three dimensional structure after folding, which occurs according to the…
Q: Bond Type: Description: ОН CH2OH ОН ОН ОН Н ОН От CH₂OH ОН Н OH-0 ОН Н ОН :CI: Nat :ci: Nat Na :CI:…
A: Chemical bonds are formed between the same or different atoms to give rise to chemical compounds.…
Q: argarines made from plants oils are healthier ,since they are hydrogenated. A) TRUE B)FALSE
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: Why does the lack of carnitine causes hypoglycemia, muscle weakness? Justify the answer…
A: INTRODUCTION : Hypoglycemia : It is a disorder or condition in which the levels of the body's blood…
Q: 1.a)Which statement is correct with respect to eggs? The white of an egg has about equal quantities…
A: Proteins are complex macromolecules that play a central role in the structure and function of all…
Q: 1. 2. NaBr 3. H₂O₂ 4. Al₂(MoO4)3 5. AgNO3 Fe₂(SO4)3
A: In one molecule of a compound how many numbers of atoms of each element are present is…
Q: Consider the reaction below. Where would the labelled carbon (represented by the asterisk * in the…
A: As you can see the reactant side is undergoing the reaction where there is removal of CO2 and NADP+…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. a)…
A: Our body primarily uses glucose as a source of energy. In order to carry out the normal functions of…
Q: Circle the functional groups on the R-group of the AMINO ACIDS below that are capable of forming…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 6. Enzyme X exhibits maximum activity at pH = 6.9. X shows a fairly sharp decrease in its activity when the pH goes much lower than 6.4. One likely interpretation of this pH activity is that: A) a Glu residue on the enzyme is involved in the reaction. B) a His residue on the enzyme is involved in the reaction. C) the enzyme has a metallic cofactor. D) the enzyme is found in gastric secretions. E) the reaction relies on specific acid-base catalysis. В1.) A sample contains 0.003 mg of NaOH. How many micrograms (μg) is this? 2.) An experiment was performed in which 400 mL of 0.2 M urea was used. Calculate the number of millimoles (mmol) of urea contained in this sample. 3.) How many micromoles (μmol) of ATP are present in 4 mL of 5 mM ATP solution..To characterize a purified enzyme, a biochemist has determined the reaction initial velocities, at various [S]。, using three different conditions: a) In the presence of the enzyme alone. b) In the presence of the enzyme and of a non-metabolizable substrate analog (compound A, at 150 µm). c) In the presence of the enzyme and of a compound that binds to the enzyme at a site different from that of the substrate (compound B at 60 µM). From his experimental results, he has drawn the Lineweaver-Burk plots (below). 1- Indicate which symbols (circles, triangles, diamonds) on the graph correspond to the experiments a, b, c. Justify your answer. 2- Determine graphically Km, Kmapp., Vmax and Vmaxapp. 3- Determine the inhibition constants Ki for the compounds A and B (i.e. the dissociation constants of complexes El). 1/V₁ (min.xM-¹) -6000 -4000 -2000 2.5 2 1.5 1 0.5 0 2000 4000 1/[S], (M-¹) 6000
- Sucrase has an optimum temperature of 37°C and an optimum pH of 6.2. Determine the effect of the following on its rate of reaction: 1) no change 2) increase decrease 3) A. increasing the concentration of sucrase B. changing the pH to 4.0 C. running the reaction at 70°C What are the functions of Allosteric enzymes What are some factors that affects enzyme activity? I. II. III. IV. V. VI. Enzyme activity can be regulated by allosteric enzymes, feedback control, and covalent modifications. T/F Examples of Zymogens are the proteases trypsinogen and chymotrypsinogen. T/F? Trypsin catalyzes the removal of dipeptides from inactive chymotrypsinogen and trypsinogen to give the active proteases chymotrypsin and trypsin. T/F The removal of a polypeptide chain from proinsulin produces the active form of insulin. T/F? A kinase can activate an inactive enzyme by phosphorylation, ie adding a phosphate group. T/F? A phosphatase can activate an inactive enzyme by removal of phosphate. T/F? Identify…A researcher is preparing a reaction mixture to test the activity of a protein. They combine the required reaction components, which contained in a final 100 ml reaction volume 200 mM NaCl, unknown concentrations of acetic acid and acetate anions and a total [H+] concentration of 790 ricromolar. Can you determine the pH of the solution? Provide the answer to one decimal place. Note: You may need to round the numbers to get the required answer. 100 Strips pH indicator strips non-bleeding pH pH 0-14 EM-Reagents Dip in-read while still moist. immerse in weakly-buffered solutions une there is no further color change (1-10 min) 3 7 5 6The enzyme urease is widely used for determining urea concentration in blood. The Michaelis constant for urease at room temperature is 2.0 mM and k2 = 2.8 × 104 s-1 at pH = 7.5. Based on the kinetic experiment, when 0.34 mM urease was used, the initial rate of the reaction was determined to be 3.49 M/sec. What is the concentration of urea in blood in unit of mM? Please keep your answer to two decimal place. Please convert all concentration unit to mM in calculation.
- Explain how running a reaction with the enzyme aldolase at a pH of 14 affects its activity Enzyme Activity e Activity 765432TO Factors Affecting Enzyme Activity 0 6543 2 6 Solution pH 8 a) It significantly diminishes activity because enzyme is denatured b) It significantly diminishes activity because the enzyme becomes too reactive Oc) It will quadruple its activity because enzyme is denatured and free Question 9 (5 points) Estimate the optimum pH required for maximum enzyme activity 10 d) It will double its activity because enzyme now has more active sites 12 Factors Affecting Enzyme ActivityWhich of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM, substrate concentration is 75 nM, the KM = 150 nM, and the Vmax = 20 nmol/min a) The rate of the reaction is 20 nmol/min! b) The rate of the reaction is between 10 nmol/min and 20 nmol/min. c) The rate of the reaction is 10 nmol/min. d) The rate of the reaction is below 10 nmol/min. e) The rate cannot be determined from the above information.Describe how you would make the following solution containing two enzymes. 1 mL total volume in Buffer X with 10nM of enzyme A and 50nM of enzyme B You are given a solution of enzyme A at 1 mg/mL and a solution of enzyme B at 1 mg/mL. The molecular weight of enzyme A is 75,000 g/mol and the molecular weight of enzyme B is 130,000 g/mol.
- For an enzyme kinetics experiment, a student prepared a reaction mixture by mixing 450 microliters of 0.75mM PNPP with 4.25ml of 0.2M Tris-HCl buffer. When he is ready to measure the absorbance, he added 0.3ml of Alkaline Phosphatase to the mixture and mixed thoroughly. What is the substrate concentration at the beginning of the reaction in mM ?Sketch on one reaction rate vs. substrate concentration graph & sketch on one Lineweaver-Burk type plot the following:a) A Michaelis-Menten enzyme with a Vmax = 60 1/s and a KM = 125 M.b) An uncompetitive inhibitor of the enzyme described in a).c) An allosteric enzyme with the same Vmax as the enzyme described in a) and follows the sequential modela) The equilibrium reaction for the aqueous dissociation of acetic acid is shown below. CH3COOH(aq) = CH3COO-(aq) + H+ (aq) Given the data in the table below and your knowledge of the "chemical standard state" (X) and the “biochemical standard state” (Xº'), answer parts a) to e). c) For the dissociation of acetic acid at 298.15 K, calculate AG and the corresponding pK₁. b) Even though by definition, AfG©(H+ (aq)) = 0 and_AƒGº¹(H+(aq)) = 0, these are different physical quantities. What precisely does each represent? Calculate at 298.15 K, AG' for CH3COOH(aq) and CH3COO¯(aq). Gibbs free energy of formation, in units of kJ mol-¹, at T = 298.15 K AfGe A¢G° -396.5 -369.3 0 CH3COOH(aq) CH3COO- (aq) H+ (aq) d) For the dissociation of acetic acid at 298.15 K, calculate ArGº¹. LOXF 0 Finally, using the formula to convert between standard states, show that that your calculated values of AG and A.Gº are in agreement. jonly this