Is it true or false? Write T (True) or F (False). a. Insulin is important for glucose uptake to the cells. Lack of insulin secretion or insulin resistance cause diabetes. b. Cardiovascular system permits blood to circulate and transport nutrients, oxygen, carbon dioxide, hormones, and blood cells to and from cells in the body. c. Valves in the Vein prevent blood cells to go back to wrong direction.
Q: explain the most likely steps of what might happen inside a MDA-MB-231 cell after it is exposed to…
A: Nowadays cancer is a very common lifestyle disorder.Among females breast cancer is one of the most…
Q: Compare and Contrast a Chlorophyll lacking plant
A: Chlorophyll-lacking plants and fungi are both organisms that lack the essential green pigment…
Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…
A: First let's try to understand these terms clearly:
Q: structure A. Proteins are made up of Each one can be called a and the peptide chain of amino acids…
A: The three-dimensional configuration of an amino acid-chain molecule's atoms is known as protein…
Q: Explain the paradox implicit in Bruce McEwen's "allostatic load" concept. How is the concept useful…
A: The allostatic load concept was given by McEwen and Stellar in 1993. According to McEwen and…
Q: 1. Give various definition for morphology? 2. What is your own definition of morphology?
A: Greek morph-, which means "shape, form," and -ology, which means "the study of something," combine…
Q: Which of the following are correct? Which one or more? a. Auditory fatigue is the increase in…
A: Auditory fatigue is basically temporary loss of hearing.There can be many reasons behind auditory…
Q: A sample of E.coli cells is transformed with a plasmid containing a transcriptional fusion including…
A: (c.) It is given that an E. coli cell is transformed with a plasmid containing a transcriptional…
Q: Palivizumab is a humanized monoclonal anitbody for the prohylaxis of resporatory diseases caused by…
A: Palivizumab is a humanized monoclonal anitbody developed to help protect against respiratory…
Q: Briefly discuss Parkinson's disease in terms of aetiology, neuropathology and clinical presentation…
A: Parkinson's disease impacts the neurological system and the areas that are under the regulation of…
Q: voltage-gated calcium channel
A: Voltage gated calcium channels(VGCC): These are the transmembrane proteins which play an important…
Q: How can public health infrastructure components be managed and enhanced to improve the performance…
A: Good health allows individuals to maintain the strength and energy needed to participate in…
Q: When a food handler doesn't wash their hands after using the bathroom and introduces noravirus…
A: Introduction Any change in the body's physicality or function causing discomfort or disability is…
Q: Part IV-Conclusion Suzanne and David did undergo two cycles of PGD. In the first cycle, the two…
A: In-Vitro Fertilization is an artifical procedure through which babies can be produced.This is mainly…
Q: How do you make a 10x solution of 1M dextrose? What should be the volume and how many grams.
A: Dextrose is a simple sugar with the same molecular formula as glucose. It is frequently used as a…
Q: How many amino acids are in KMT2D peptide sequence?
A: Introduction Organic substances known as amino acids have both functional groups for amino and…
Q: List what has to happen to pre-mRNA before it is considered mature mRNA
A: Pre-mRNA are formed when RNA transcript is firstly made in eukaryotic cells. This pre-mRNA has to be…
Q: What is true about the geographic context of trees and keys? a. Neither phylogenetic trees nor…
A: Geographical context means that some organisms may not be distributed worldwide that is they may be…
Q: The first product of genome expression is transcriptome but what happens if the RNA of the genes are…
A: Transcriptome is the collection of the all the RNAs both the coding and non-coding type present in a…
Q: The following drawing represents simultaneous transcription and translation in E. coli. Answer the…
A: We all know that central dogma is a very basic procedure to produce proteins.But there are several…
Q: should be minimum one paragraph explaining statement Groups of organs with specific structures and…
A: An organ is a structure made up of different types of tissue that performs a specific function or…
Q: Explain how the temperature of the human body is regulated
A: Maintaining constant bodily conditions is part of homeostasis. The stability of the environment is…
Q: draw the p21 promoter in a cell without E2F
A: Promoters are crucial for regulating gene expression, as they determine when, where, and how much of…
Q: The Tropical regions are likely to have more biological diversity than the Temperate ones. Give two…
A: Biome is the distinct ecological community of animals and plants that exist together in a particular…
Q: B. Write the function/s of each part of the microscope listed below. a. Eyepiece b. Draw tube c.…
A: An instrument, microscope is used to observe tiny objects even cells. It examines the objects that…
Q: 5. In the image below, the focus lines are shown. What can be done to bring the apple into focus? O…
A: In the image, To bring the apple in focus, Move the apple farther from the eye.
Q: NH₂ 1 N= CH: A B C C-N 3-4 HC HICI I OH B HICIO с OH E HICIH -21 High-energy bonds 044 P-O G O-P-O-…
A: ATP stands for Adenosine triphosphate.It is the energy currency of the cell.It is considered as…
Q: Drag the correct enzyme and drop it on the correct function Cutting DNA Forms phosphodiester bonds…
A: Note: According to bartleby guidelines only first question is to be answered. DNA: A polymer made…
Q: 3. Beetles of a certain species may have green, blue, or turquoise wing covers. Virgin beetles were…
A: Gene It refers to the basic unit of heredity which is passed from parent to progeny. It constitutes…
Q: Trace the events from copulation to zygote formation in a human female.
A: Introduction: A gamete joining is referred to as fertilisation. Sperm and egg combine during…
Q: What controls the amount of light reaching the ocular lens?
A: "Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: For #2 through #4, calculate the following and fill in the answers in the table below. 2. Add 2500ml…
A: Units are used to refer to a specific physical quantity of a substance or object such as its weight,…
Q: Which of the following amino acids contain nonpolar R groups? --/$$/-- 1 2 1 НО NH₂ OH 'OH NH₂ 3 4…
A: Non-polar amino acids are those amino acids are bulky because their side chains have lengthy carbon…
Q: Carbohydrates are classified by The most common simple sugars are glucose, galactose and fructose…
A: Introduction:- Biomolecules are the carbon containing organic compounds, present in the living…
Q: Transcription start site selection by S. cerevisiae Pol II occurs over a range of positions located…
A: Introduction: Transcription start sites (TSSs) are acquired by RNA polymerase II (Pol II) in…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: 1. All organisms use similar energy-carrying molecules which shows the "grand unity of life". Name 2…
A: The universal 2 energy carrying molecules are ATP and NADH or in case of plants NADPH.
Q: What characteristics does a lizard have to adapt to desert wind and dust storms? For example what…
A: Reptiles and amphibians can live in desert environments without suffering from extremities of…
Q: Several misconceptions are present in the general knowledge of how our brains work and as portrayed…
A: The brain is the organ in the body that controls all functions, including basic survival activities…
Q: Considering its metabolic properties, what advantage might the phototroph in the “Chlorochromatium…
A: Introduction: A phototrophic consortium known as Chlorochromatium aggregatum may be the highest…
Q: Differential RNA splicing may result in: a. A shift in the ratio of mRNA produced from two…
A: The process of removing the introns from the immature RNA and ligating the exons is known as RNA…
Q: Suppose that goats have one gene that codes for color, where A is brown and a is white. The goats…
A: The alleles that an individual carries are inherited from each parent. The dominant…
Q: Priestley's experiments provide solid evidence that shows that plants give off oxygen. Combining…
A: Metabolic processes are the activites takes place inside the living organisms in which either large…
Q: How is the correct bacterial symbiont selected in the squid–Aliivibrio symbiosis?
A: Squid rely on Allivibrio bacteria to produce light, which helps them to mix in with light from…
Q: Fill in the blank with the most appropriate response: Regardless of discipline, __________ is…
A: Regardless of discipline testing hypotheses is central to all modes of scientific inquiry
Q: Palivizumab is a humanized monoclonal anitbody for the prohylaxis of resporatory diseases caused by…
A: The virus is the submicroscopic infectious agent which infect the host cells like plant, animal or…
Q: Using the techniques below in the laboratory experiments, devise a detailed methodology in solving…
A: DNA testing and analysis can identify an individual's unique genetic makeup and help tailor…
Q: The genetic diversity of the moss Polytrichum commune was analysed in two peat bog ecosystems.…
A: A species' genetic diversity refers to the variation in its genes and genotypes. It is critical for…
Q: What controls the direction of movement of ions across the membrane? A. Peripheral proteins B.…
A: The creation of ion gradients across the plasma membrane is necessary for the flow of ions through…
Q: The function of DNA ligase is to: a. Catalyze formation of phosphodiester bonds between adjacent…
A: DNA ligase plays a crucial role in the synthesis, repair, and replication of DNA molecules. It is an…
Plz asap
Step by step
Solved in 4 steps
- You have just diagnosed lactic acidosis and associated coma. What is the first medication that should be administered in this situation?A. 8.5% Sodium Bicarbonate dripB. 20-25 U of short-acting insulin IV (intravenous)C. 40-60 U of short-acting insulin SQ (subcutaneous)D. 50-10 cc of 40% glucoseE. 400-500 cc of 5% glucoseNeuropathy is a potential complication of diabetes. Why does it occur? Select one: A. Viral infection in the nerves B. Lack of glucose production by the nerves o C. Blockage of blood vessels that supply the nerve fibers O D. Excessive production of glucose by the brain and spinal cord E. Overproduction of ketone bodies by the liver O OInsulin therapy has all of the following effects, except:A. Increases concentration of free fatty acids in blood plasma B. Stimulates glucose uptake by tissuesC. Inhibits lipolysisD. Activates protein synthesis
- All statements are related to blood sugar, Select the one that is NOT true. A. insulin is released by the pancreas if blood sugar is too high B. In Type I diabetes, an individual cannot make insulin due to damaged pancreas cells C. Insulin is a blood enzyme that helps convert blood sugar into glycogen D. excess blood sugar is stored in liver and muscles as glycogen E. glucogon is released by the pancreas to help blood sugar be released if blood sugar is too lowndicate whether each of the following statements is true or false. If false, correct the statement or provide a briefexplanation for why it is false.a. Insulin increases the rate of glucose uptake by the tissues.b. Glucagon is the hormone that signals low blood glucose levels.c. The muscles can use glucose, fatty acids and ketone bodies for fuel.d. Epinephrine stimulates breakdown of glycogen in muscles when there is an immediate needfor energy by muscle cells.e. Glucagon stimulates glycogenolysis to maintain the blood glucose concentration.f. With high [carbohydrate] levels, excess glucose (after glycogen storage has reached amaximum) is converted to fat.g. The high potential electrons of NADH enter the respiratory chain at NADH-Q reductase.h. Ubiquinol (QH2) is also the entry point for electrons from NADH of flavoproteins.i. Cytochrome reductase catalyzes the transfer of electrons from cytochrome c to O2.Which of the following side effects is not usually seen with overdose of calcitriol (vitamin D3) during treatment of hypoparathyroidism?A. HypercalcemiaB. Arterial hypertensionC. Metallic tasteD. HypocalciuriaE. Myalgia
- Insulin should be prescribed under all of the following circumstances, except:A. Status post pancreatectomyB. Type 2 diabetes with diabetic foot syndrome C. Type 1 diabetesD. Gestational diabetesE. Type 2 diabetesSir Charles blood sample was taken at 9am for serum cortisol in addison disease. The Laboratory result for the cortisol level is 36mg ( reference > 55mg). a. What is the essence of the time in taken the blood sample b. What is the major cause of the addison disease. c. How will you investigate addison disease in the lab. d. What is the likely symptoms and signs in addison diseaseSelect the letter of the choice that best completes the statement. A decrease in the production of insulin causesa. diabetes mellitus.b. diabetes insipidus.c. cretinism.d. exophthalmos.
- Which of these is (are) expected in Cushing syndrome (hypersecretion of adrenal cortex hormones)?a. loss of hair in womenb. deposition of adipose tissue in the face, neck, and abdomenc. low blood glucosed. low blood pressuree. All of these are correctNeuropathy is a potential complication of diabetes. Why does it occur? Select one: A. Overproduction of ketone bodies by the liver B. Viral infection in the nerves C. Lack of glucose production by the nerves D. Blockage of blood vessels that supply the nerve fibers E. Excessive production of glucose by the brain and spinal cordWhich of the following statements about insulin is true? a. Insulin acts as a transport protein, cany in g glucose across the cell membrane. b. Insulin facilitates the movement of inti acellular glucose transporters to the cell membrane. c. Insulin stimulates the breakdown of stored glycogen into glucose. d. Insulin stimulates the kidneys to reabsorb glucose into the bloodstream.