In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are sorted is Select one: O 1. log2(n) O 2. nlogn O 3. n 4. None of above
Q: ) *When double-stranded DNA is heated, the two strands separate into single strands in a process…
A: Factors affecting Tm The temperature at which half of the dsDNA is denatured is called T_{m}…
Q: What would be the final primer concentration if 0.5 ul of 10 uM primers were ad a PCR reaction with…
A: Introduction: A primer is a short strand of DNA or RNA that is usually about 18-22 bases and serves…
Q: According to Chargaff's observations of nucleotide composition of DNA samples OA % of (G + C) + % of…
A: Chargaff's rule has been stated for the DNA, which states that the ratio of purine and pyrimidine…
Q: Refer to the attached DNA model. In the spaces provided on the attached table, identify the…
A: DNA or deoxyribonucleic acid is the genetic material present in most organisms. It is composed of…
Q: In order to determine the purity of a DNA sample. spectrophotometry can be carried out at…
A: DNA absorbs the UV light at an absorbance of 260nm of the wavelength.
Q: If you amplify a single double-stranded (ds) DNA template molecule using 25 PCR cycles, how many ds…
A: The polymerase chain reaction is a method for cloning a particular piece of DNA to make virtually…
Q: A plot showing the % of denaturation as a function of temperature for a melting point of a DNA…
A: DNA is a double stranded helically wound macromolecule. Each strand is made up of a sequence of…
Q: Suppose there are three tubes containing following samples in the laboratory. The three tubes are…
A: DNA(deoxyribonucleic acid) is defined as the building block of life because it carries all the…
Q: What allows the peaks to be different colors?
A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…
Q: In Noll’s experiment to test the beads-on-a-string model, exposure of nuclei to a low concentration…
A: Markus Noll's experiment to test the Kornberg's model of Nucleosome, also known as beads-on-string…
Q: How many fragments are produced if ddT is added to the following DNA segment during Sanger…
A: DNA is arranged in a specific sequence of nucleotides. The sequence consists of four types of…
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: Why are the first 20 bases typically ignored from a Sanger sequencing .ab1 file? The data quality is…
A: The data quality is too low and the data is noisy
Q: What does the symbol “N” indicate (see the arrow)? Is this a problem for getting an accurate DNA…
A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…
Q: L 1 2 3 Locus A Locus B L = Standard marker 1 = Suspect 1 2 = Suspect 2 3 = DNA from crime scene %3D…
A: The biotechnology is a branch of biology that deals with different techniques that help…
Q: onsidering the number of base pairs, compute for the actual length (in micrometers) of this DN
A: There are 7 base pairs. Length of one base pair is 3.4 Angstrom. Length of 7 base pairs is 3.4 X 7=…
Q: In order to determine the purity of a DNA sample, spectrophotometry can be carried our at Answer to…
A: Spectrophotometry is the quantitative analysis of spectra to compare the relative absorption or…
Q: In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging…
A: The fragments of DNA synthesized by DNA polymerases during lagging strand synthesis are described as…
Q: Put the following pieces of DNA in order that they would appear reading from the top (nearest the…
A: First of all lets convert all of them into single unit 1kb = 1000bp So, 21000bp =21kb 10000bp = 10kb…
Q: Why are the first 20 bases typically ignored from a Sanger sequencing ab1 file? O The data quality…
A: The most commonly used tool for detecting SNVs is Sanger sequencing, it involves DNA polymerase…
Q: When running a gel during a Sanger sequencing, the following results were obtained: I I Find the DNA…
A: Sanger sequencing is a technique which is used to determine the order of the four nucleotide bases…
Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…
A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…
Q: The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA molecules from nucleoside…
Q: Based on the following image: A) Identify the largest DNA fragment in sample 5. Explain your…
A: In the given question, an agarose gel is shown which is having bands of DNA in different lanes. DNA…
Q: Single stranded binding protein A coats ss DNA to keep it single stranded b bind double…
A: Single-strand DNA-binding protein (SSB) is a protein found in Escherichia coli (E. coli) bacteria.…
Q: Which of the following is TRUE with respect to electrophoresis? a. DNA is not attracted to either…
A: Electrophoresis is defined as the motion of dispersed particles relative to a fluid under the…
Q: The Watson-Crick double helix immediately suggested that DNA is replicated in a manner. a. semi…
A: The genetic material is transmitted to the next generation through DNA. A cell leads to several more…
Q: 100 F В A 75 80 85 90 95 100 105 110 115 120 125 Temperature (°C) A) What is the tm of the most…
A: DNA is a double-stranded helical molecule. The monomer of DNA is a nucleotide. A nucleotide…
Q: What is a DNA Ladder? a solution added to a DNA sample to give it color for an electron microscope.…
A: DNA: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…
Q: of the following DNA models is accurately labeled? a. b. A d. 3'
A: The molecule found inside cells that holds the genetic information necessary for an organism's…
Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…
A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: An individual’s unique set of_______ can be used in DNA profiling. a. DNA sequences c. SNPs b. short…
A: Introduction In the genome, there is usually two types of nucleic acid sequence present. One is…
Q: What is a DNA Ladder?
A: Answer :: 1) DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms.…
Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts.…
A: Restriction enzymes The enzyme that is use to cut the DNA at specific site.
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. B…
A: B- DNA is the most common form of DNA. It is the right-handed helix and is present in humans which…
Q: In lane 1, a size standard was loaded, which contained a mix a DNA fragments known to be 1000 bp,…
A: Gel electrophoresis is a gel technique that uses an applied electrical field to separate nucleic…
Q: You have two DNA samples, A and B. A 1/10 dilution of sample A had an absorbance at 260nm of 0.12. A…
A: Nucleic acids strongly absorb UV light with wavelengths of 260 nm due to the resonance structure of…
Q: (AKS 8a2, DOK 1) A gel from gel electrophoresis is shown below B. Which DNA Fragment is the…
A: Gel electrophoresis is an analytical technique which is used for the separation of DNA; RNA and…
Q: Which one of the following statements is true about gel electrophoresis of DNA? Select the correct…
A: In electrophoresis, the current is applied to separate DNA fragments based on charge.
Q: The 260/280 ratio of pure DNA is between 1.8- 35 2.0. The absorbance of DNA at different 30…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: Which of the following is the correct order in extracting the DNA? I. Washing of DNA II. Tissue…
A: DNA act as genetic material in most of organism . It is two stranded , ladder like structure . DNA…
Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…
A: The process of indexing a genome is similar to that of indexing a book.
Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…
A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…
Q: Which one of the following statements is true about gel electrophoresis of DNA? Select the correct…
A: Gel electrophoresis is a technique used in laboratories to separate DNA, RNA, and protein mixtures…
Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…
A: The answer is 100 kb .
Q: To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are…
A: A Coverage is multiplier based on total size of the genome. Formula = Coverage = (read length) x…
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…
A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…
Q: Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite…
A: Some of the similarities between microsatellite and minisatellite are that both are type of tandem…
Q: TFIIF Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…
A: TFIIF It is a eukaryotic transcription factor. It is involved in the formation of the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- A sample of DNA with the sequence 5'- CTC GAG CGA AGC TCA ACC-3' he was obtained as a dry solid. The sample was dissolved in 1000 µl of deionized water ane mixed well. Ten microliters of the dissolved sample was then transferred to a new sampie tube and mixed with 990 ul of water, The dilute sample had A260 = 0.156. What was the concentration of the original sample (the solid dissolved in 1000 ul of deionized water)Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?Permutation is the ordered arrangement of m number items out of a list of n items. For instance, the DNA strand with sequence of 3 bases: G-A-C IS different w ith A-G-C, C-A-G, G-C-A, A-C-G, and C-G-A. From this, we have: P-3) 3! 3x2x1 Therefore, there are 6 dıfferent sequences of DNA strands that can be formed out of 3 given bases. In general, we have this formula for permutation: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne (6 bases) be sequenced in one DNA strand?
- Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHThe genetic distance between DNA sequences 1 and 2 is what value? 1 T C G A C A C c G G A T T 2 А т с с А с с с о с G А Т 4 O 5What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
- That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
- The photograph provided is of a 1 μg of 2-log ladder indicating the molecular size in kilobases (Kb) and amount of DNA per band in ng. Estimate the concentration of your PCR product (amplicon) in ng/μL by visual comparison. The expected size of your amplicon is about 600-bp (0.6 kb). ____μg/μL?Can you please help with 1c please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…Please answer You have received a dehydrated sample of DNA primer at a concentration of 19.9 microM. what volume (in microlitres) of buffer would you add to achieve a solution of 100nM of this primer? Show workings.