How many fragments are produced if ddT is added to the following DNA segment during Sanger sequencing? 3-GGTCATGATTCAG-5' O 2 O 3 O4 O no fragments are formed
Q: A piece of human DNA is treated with two common restriction enzymes. The DNA piece in question is 50…
A: Restriction enzymes are a specific group of enzymes that can recognize a specific short sequence of…
Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…
A:
Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…
A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…
Q: Which of these is not a tool for comparing DNA sequences? PLINK Fasta BLAST A dotplot e.g. dotlet
A: DNA polymerase is an enzyme. A primer is a single-stranded DNA fragment that binds to template DNA…
Q: What allows the peaks to be different colors?
A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…
Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: A linear piece of DNA was broken into random, overlapping fragments and each was sequenced. The…
A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…
Q: A cloned fragment of DNA was sequenced by using the dideoxy method. A part of the autoradiogram of…
A: Sanger sequencing, often called chain-termination sequencing, is a DNA sequencing technology…
Q: Which of the following is not a function of single-strand binding proteins? O prevents reformation…
A: SSBPs : Also called the single-strand binding proteins are a key component of the DNA replication…
Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…
A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…
Q: The illumina method of sequencing uses a unique type of nucleotide building block. What is the…
A: The illumina sequencing is a DNA sequencing method used to determine single nucleotide bases of a…
Q: Which of these statements is correct regarding the complimentary sequence to this DNA strand: 5' -…
A: Nucleotide are elemental unit that forms genetic material that is DNA and RNA . It consists of :- I…
Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…
A: Nucleic acids are one of the four main classes of biomolecules synthesized from monomeric units…
Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…
A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…
Q: In E.coli, the following enzymes do NOT synthesize the RNA primer for Okazaki fragments?
A: Introduction:- E.coli,like most bacteria, has a single origin of replication on its chromosome. As…
Q: E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww…
A: DNA Sequencing is the technique to determine the order of the nucleotides within the DNA…
Q: Which of the following ingredients does not belong in a sequencing reaction? ddNTPs Primer © Ligase…
A: Sequencing of DNA The technique to know the exact order of base pairs (nucleotide) in a DNA.
Q: How many potential methylation sites are present for the following DNA strand?…
A: 3 types of methylation sites. option 2 is the correct answer. Count the number of "C"s and "T"s at…
Q: Why are the first 20 bases typically ignored from a Sanger sequencing ab1 file? O The data quality…
A: The most commonly used tool for detecting SNVs is Sanger sequencing, it involves DNA polymerase…
Q: Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and…
A: DNA denaturation is the breaking down of DNA molecule, for comparison or sequencing. DNA can be…
Q: When running a gel during a Sanger sequencing, the following results were obtained: I I Find the DNA…
A: Sanger sequencing is a technique which is used to determine the order of the four nucleotide bases…
Q: The bisulfite sequencing is different from regular sanger sequencing of nucleotides because…
A: The Sanger sequencing is also known as the chain termination method, it is a method used to…
Q: What is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis…
A: Sanger sequencing method is chain terminating method.
Q: A-DNA is a double-stranded form of DNA that has a helical radius and helical pitch compared to the…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5…
A: DNA stands for deoxyribonucleic Acid. It is a long polymer of deoxyribonucleotides. It is found in…
Q: Please check the pic. Find out where the divisions between fragments are , the number of fragments…
A: An important enzyme is EcoRI, plays an important role in recombinant DNA technology. These enzyme…
Q: A DNA fragment with the following base sequence has some cytosine bases that are methylated…
A: The bisulfate sequencing is the treatment of DAN with bisulfite before the routine sequencing for…
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: DNA pol III DNA ligase…
A: Introduction: DNA is the hereditary material that defines every cell. It is found within the nucleus…
Q: If you have five test tubes each containing a double stand DNA, which of the following double…
A: Answer- The denaturation of DNA is depend on the melting temperature and the composition of the…
Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: What is a DNA Ladder? a solution added to a DNA sample to give it color for an electron microscope.…
A: DNA: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…
Q: In which sequencing method, DNA is labelled and then chemically cleaved in a sequence-dependent…
A: DNA sequencing refers to decoding the base sequence of the DNA strand. It tells us the base…
Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…
A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: a. Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…
A: DNA replication helps DNA to double itself.
Q: Which lane shows the DNA fragment completely digested with Pst n
A: Restriction endonuclease are the enzymes which cleave the DNA at specific sites Various sites are…
Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…
A: the genome is never a static entity, it constantly undergoes changes in its sequence either due to…
Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…
A: PCR It is a Polymerase Chain Reaction which is a technique through which a specific fragment of DNA…
Q: Which of the strands of DNA could act as a PCR primer for the DNA sequence shown below?…
A: Primer It is a short, single-stranded sequence of DNA which is used in the PCR technique. It is used…
Q: When lambda DNA is cut with HinDIII what is the size in base-pairs of the smallest restriction…
A: Restriction enzyme cuts the DNA at specific recognition site. These are palindromic in nature.
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: Translate the following opposite strand of DNA based on the nucleotide bases. ATTGACTGG
A: The genetic code is a series of three-letter nucleotide combinations called codons, each…
Q: Which of the following is the correct order in extracting the DNA? I. Washing of DNA II. Tissue…
A: DNA act as genetic material in most of organism . It is two stranded , ladder like structure . DNA…
Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…
A: The guanine and adenine are purine bases. These are composed of 5 and 6 sided ring. Thymine and…
Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…
A: The process of indexing a genome is similar to that of indexing a book.
Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…
A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…
Q: The length of the entire human reference genome is about Select one: O 1.3 billion bases O 2. 300…
A: 3 billion
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…
A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…
Q: The sizes of the restriction fragments produced by cutting bacteriophage lambda DNA (48,502 bp) with…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
3
Step by step
Solved in 3 steps
- Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Match the following DNA template segment with its complementary segment. 5' AGGTCCG 3' 3' TCCAGGC 5' 5' TCCAGTT 3¹ 3' TTAGCTA 5' 5' TCCAGGC 3'
- Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.
- If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.