In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand) What products would be formed from the segment's replication? Write the mRNA sequence that would be obtained from the segment's transcription. What is the amino acid sequence of the peptide produced from the MRNA?
Q: 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter…
A: transcription is the process of formation of mRNA from the DNA sequence Translation is the process…
Q: What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?
A: Transcription and translation are processes that a cell employs to create all of the proteins…
Q: DNA sequence
A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…
Q: transcribed RNA
A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…
Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.
Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Provide the complementary strand and the RNA transcription product for the following DNA template…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: Which of the following is NOT a part of transcription? O Double-stranded DNA is unwound and forms a…
A: Transcription is the process of copying genes in DNA into mRNA sequence where they form…
Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence…
A: Introduction :- The proteins are synthesized with the help of protein synthesizing machinery which…
Q: (a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the…
A: Proteins are the biological polymers of amino acids. They are formed by peptide bonds by polypeptide…
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: DNA is composed of different nucleotides that consist of genetic information in genes. If two copies…
Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…
A:
Q: The following is the base sequence of an exon portion of a template strand of a DNA molecule: 5'…
A: Introduction :- DNA acts the genetic material , present within the nucleus of a cell . It is a…
Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…
A: Gene expression is the process by which the instructions in the DNA is converted into a functional…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…
Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?
A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…
Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…
A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: A segment of one strand of a double-strandedDNA molecule has the sequence 5�-ACTTTCAGCGAT-3�. Whatis…
A: Transcription is the process of making an RNA copy of a gene sequence. As the nucleotide sequence of…
Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…
Q: Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs…
A: The process by which a cell makes an RNA copy of a piece of DNA. This RNA copy, called messenger RNA…
Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?
A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…
Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…
A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…
Q: . Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate…
A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…
Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting…
A: Central dogma- RNA is produced from DNA with the help of transcription and then RNA is converted to…
Q: If the following piece of DNA were used as a template for transcription, what would the sequence of…
A: Transcription the process in which RNA is formed out of the DNA the processing that is translation.…
Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…
A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…
Q: A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct…
A:
Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA…
A: Gene expression is the process by which the instructions in our DNA are converted into a functional…
Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?
A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: DNA Transcription and Translation Directions: 1. Transcribe the DNA sequences below into MRNA. Read…
A: mRNA sequence: 3'C A U A G G G A A C U G A A G U U U C C C G G G U A C U U C C C A5'
Q: In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA…
A: Eukaryotic cells are huge and sophisticated creatures having a nucleus encased within the nuclear…
Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…
A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…
Q: During DNA replication a mutation occurs that reuskt in the following chnage in the corresponding…
A: It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins…
Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which…
A: According to the central dogma of life, DNA replicates to form copies of itself. DNA acts as a…
Q: If the DNA has a triplet code of CAG in one strand (the strand used as a template for transcription)…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…
Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…
A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…
Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…
A: The information from the DNA is transferred to RNA by transcription. The information present in the…
Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…
A: Nucleotides The bases found in the molecules of DNA are known as nucleotides. They are the building…
Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…
A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: 2 3 3' 5' ATGACGGATC UACUGCCUAGUC 5 SCAAGCGGAATTGGCGACATAA GCGUU 3…
A: Genetic information is transferred from DNA to the proteins via RNA by the process of transcription…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Here i discuss about the coding strand, antisense strand of DNA, their transcribed products as well…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
- 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…
- 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are the tRNA anticodons of the mRNA codons from item 1? 3. What is the complementary DNA strand of the mRNA strand from item no 1? 4. The DNA strand from item 3 undergoes replication. What will be its complementary DNA strand?The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'
- 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine3. You have assembled a very short contig below, but you don't know if this is the sense or antisense strand. Determine the mRNA sequence in either case, and then provide a 6 frame translation. 5' - ATACGGGCAATTACAGTCTAGA – 3' If this is the sense (+) strand, what is the corresponding mRNA sequence? If this is the antisense (-) strand, what is the corresponding mRNA sequence? For BOTH mRNA sequences you just determined, provide a 3 frame translation for each (i.e. a 6 frame translation, in total)
