8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating theMRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein.DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5'DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3'MRNA 5'ProteinUCAGUCAGUCPGAlanineGUU/cGUATyrosineCStopAGCysteineValineG AStopG TryptophanArginineA GACACUGACUGACUCLeucineSerineGCALysineProlineAsparagineGlycinealanineLeucinePhenyl-SerineGlutamicacidAsparticacidHistidineGlutamineThreonine

The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' СCGTGAATАCGCTACGGAАСТСАСТGGTА 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein Alanine Tyrosine A Stop Valine GU Cysteine G Stop Tryptophan Arginine G AC U Serine Leucine Lysine Proline Asparagine GACUGACU Serine opusol Histidine Threonine

8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' СCGTGAATАCGCTACGGAАСТСАСТGGTА 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein Alanine Tyrosine A Stop Valine GU Cysteine G Stop Tryptophan Arginine G AC U Serine Leucine Lysine Proline Asparagine GACUGACU Serine opusol Histidine Threonine

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcription
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
thank you
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of the coding sequence: Write the double-stranded DNA sequence that corresponds to the MRNA above. Label 5' and 3' ends. Would transcription have occurred using the top or bottom strand as the template? Imagine you discover a mutation in the DNA, within the coding sequence of the corresponding mRNA above. You determine that the mutation does not result in a change to amino acid sequence. What is the most likely reason for this?
Consult the DNA below. Only one strand is shown (the complementary strand is not shown). What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................