How would we amplify the target DNA associated with PTC tasting? O We use restriction enzymes to amplify the DNA. O We use polymerase chain reaction (PCR) to amplify the DNA. O We use single nucleotide polymorphism to amplify the DNA. O We use restriction fragment length polymorphism (RFLP) to amplify the DNA.
Q: Determine what amino acid will be formed from the given DNA strand below: ...
A: Transcription Formation of RNA over DNA template is called transcription. Out of 2 strand of DNA on...
Q: hy transcription initiation requires the assembly of transcription regulatory proteins on DNA sites ...
A: Transcription The process of converting a piece of DNA into RNA . Messenger RNA is created when se...
Q: Which of the following is not an assumption made when evaluating Michaelis Menton kinetics? the reac...
A: An enzyme is a biocatalyst that increase the rate of chemical reaction without itself being change...
Q: What do steroid and peptide hormones typically have in common? their solubility in cell membranes th...
A: The chemical substances that are synthesized and produced by the endocrine glands to control and reg...
Q: Do we have ethical obligations toward other species?
A: Ethics should be the every human activity wheather it is research or dialy life activity. Because al...
Q: Why are deserts typically found at 30° N and S in latitude? Group of answer choices Hadley Cells cau...
A: Desert: environment areas where annual rainfall is less than 25 cm are marked as deserts. Almost all...
Q: A farmer wants to keep geese out of their field. This farmer builds a fake Coyote to scare away the ...
A: Correct option is Associative learning (option 4).
Q: Can you tell me about the contribution of Don Francis in the society's knowledge about HIV?
A: AIDS is an Acquired Immune disorder syndrome that is caused by HIV (Human Immuno deficiency virus). ...
Q: 1. An earthquake and tsunami, Richter scale of 7, destroyed a small village near the epicenter in ...
A: *Sympatric speciation means the splitting of an ancestral species into two or more groups that are ...
Q: . In an interrupted-conjugation experiment in E. coli, thepro gene enters after the thi gene. A pro+...
A: Part A. The genotypes of the two types of cultures are: pro+ thi- They grow only on the media that...
Q: What are the trends of the gametophyte in the evolution of plants?
A: All plants and some algae species have a stage in their life cycle known as the gametophyte. Sporoph...
Q: Female Reproductive System: Complete the table 4 Number Structure Function 4. Male Reproductive Syst...
A:
Q: Movement of Earthquake waves through the ground can produce
A: Seismogram recording Are seismic waves like sea waves? Indeed, here and there. Sea waves travel at t...
Q: What are viruses? How do they enter and replicate within the human body?
A: Viruses are nucleoprotein entity which is able to utilize the synthetic machinery of a living cell o...
Q: In Figure 5-15, how are each of the following genotypesproduced?a. F+ a− c. F− a+b. F− a− d. F+ a+
A: Recombination is a technique by which pieces of DNA are broken and recombined to produce new combina...
Q: In which phase are chromosomes not visible? O prophase O anaphase interphase O metaphase
A: Under the microscope, gross changes are not accompained during interphase of cell cycle. In interpha...
Q: Why is it difficult to cure AIDS?
A: * Human immuno deficiency called HIV that attacks body immune system. *if HIV is not treated it can ...
Q: What are the main morphological differences between monocot plants and dicot plants?
A: Morphological features refer to the outward appearance of a plant. These change in response to diffe...
Q: describe the usual role of salivary and pancreatic amylase in digestion : identify reactant : ...
A: * Amylase is an digestive enzyme helps in digestion. *Amylase enzyme function is to hydrolyze starch...
Q: If births and immigration are greater than death and emigration how will a population change? Group ...
A: A Population has different attributes which helps to compare two different populations.
Q: What are the five primary causes of biodiversity loss? Give one specific example of each
A: Biodiversity loss is caused by five primary major factors: habitat loss: An example of such factor ...
Q: What is the critical photoperiod? How can the critical photoperiod of flowering be experimentally de...
A: Angiosperms are capable of producing flowers that are the reproductive structure in plants and take ...
Q: As described by the Optimal Foraging Theory, and animals feeding behavior should maximize ________ a...
A: Here the correct option is- 1. Maximize nergy obtained, minimize social interactions. And 3. Maximi...
Q: summarize basic information with photos: Family name, scientific name, common name, hosts/damage, li...
A: The eastern spruce budworm is a species of moth. It causes severe damage to some trees. Spruce budwo...
Q: A microbial geneticist isolates a new mutation in E. coliand wishes to map its chromosomal location....
A: A mutation is a sudden change in the DNA sequence. Mutations can result from mistakes during DNA cop...
Q: If a gamete of an unknown animal species has 18 chromosomes, how many chromatids are at anaphase I? ...
A: Introduction: Chromosomes are the condensed form of chromatin present in the nucleus of the cells. T...
Q: Which of the below factors is likely to cause density independent limits to population growth? Group...
A: Population is a group of individuals that found in a particular area.
Q: As we go back in time, the number of our direct ancestors' increases but the number of humans who we...
A: Coalescence: it is used in evolutionary biology to determine the distribution of gene divergence.
Q: Prey have evolved many adaptations to predators. A green lizard that lives in a green tree is showin...
A: The distinct color in different animals is very much important in studying the animal behaviour and ...
Q: QUESTION 3 Which of the following occurs under stressful conditions that include shock, low blood pr...
A: Stress Stress is the feeling of emotions or physical tension.
Q: What phylum is the closest relative of nemertines? Why?
A: Nemertines: Nemertea, sometimes known as ribbon worms or proboscis worms, is a phylum of organisms....
Q: Identify the factors that contribute to total peripheral resistance.
A: Introduction :- The resistance to blood flow offered by all of the systemic vasculature, excluding t...
Q: QUESTION 4 Which of the following could contribute to poor health in people who experience chronic s...
A: Chronic stress Chronic stress can cause or worsen many serious health problems, including: Mental h...
Q: Prey have evolved many adaptations to predators. A green lizard that lives in a green tree is showin...
A: Predators and prey evolve together. Over time, prey animals develop adaptations that help them avoid...
Q: Why is it important that in an aquatic environment, there are several receptors?
A:
Q: Calculate the amount of phycocyanin in Sample 1 in mg where A620=0.192 and A650=0.090, taking into...
A: Phycocyanin is a protein-pigment complex that is a member of the phycobiliprotein family. It's a wat...
Q: SEQUENCE 28 SEQUENCE 21 SEQUENCE 22 SEQUENCE 23 SEQUENCE 24 SEQUENCE 25 SEQUENCE 26 SEQUENCE 27
A: A phylogenic tree represents the evolutionary relationship between species or even proteins. The phy...
Q: In Figure 5-32, what do the half-red, half-blue segmentsrepresent?
A: Biotechnology is a branch of biology that utilizes biological systems that is living organisms such ...
Q: What is the phenomenon of apical dominance in plants? How can it be artificially eliminated?
A: Introduction :- Apical dominance is a phenomenon in botany in which the plant's main, central stem i...
Q: What are cerebrovascular accidents?
A: The supply of oxygen to the brain is carried out by blood. Blood contains oxygen-carrying molecules ...
Q: Unpacking Problem 411. What type of organism is E. coli?2. What does a culture of E. coli look like?...
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: How does the processes of cellular respiration impact the global carbon cycle? Group of answer choic...
A: Cellular respiration involves metabolism of glucose in the presence of oxygen (aerobic cellular resp...
Q: After irradiating wild-type cells of Neurospora (a haploid fungus), a geneticist finds two leucine-r...
A: Part A. In the given question, the different types of alleles that are mutant in nature are brought ...
Q: What is Parkinson's disease?
A: Introduction In this question we will discuss about the Parkinson's disease.
Q: Differentiate between a genetic disorder and a geneticabnormality
A: Genetics is the study of genes. The expression of genes can affect the phenotype of an organism. Aff...
Q: Which mutation, if it occurred in an individual’s mother, could be passed on to her child?
A: The type of mutation which is passed on to the child from their parents is called a hereditary mutat...
Q: What is the evolutionary importance of the emergence of seeds in the plant kingdom?
A: Introduction In this question we have to discuss about the importance of the emergence of seeds in t...
Q: List down the similarities and differences present between a cnidarian medusoid and an adult ctenoph...
A: List down the similarities and differences present between a cnidarian medusoid and an adult ctenoph...
Q: What plant tissues are responsible for supporting of plant?
A: Introduction In this question we have to write the tissues responsible for supporting of plant.
please help with practice problems
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.What is the principle of the Restriction Fragment Length Polymorphism (RFLP) in the diagnosis of human diseases? O a. PCR product of a gene is different from the expected one b. The size of a recombinant DNA is different from the expected one OC. The size of a band digested by specific restriction enzymes is different from the expected one O d. The DNA band detected by Southern blot is different from that by Northern blotExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
- For separating DNA of different sizes, you would use Question PCR Questi Gel electrophoresis Restriction enzymes 1 Listen Crispr For making specific DNA changes in living organisms, you would use ** Crispr Restriction enzymes Gel electrophoresis PCR ◄0 Listen You are interested in identifying genes that determine tail length in dachsunds. You analyze the genome of several dachsunds and look for SNPS that correlate with tail length. The results are shown here pog Spot Rover Chase Frisbee Cin Checkers SNP 1 SNP 2 SNP 3 Tail Length (cm) 10 12 SNP 4 9 4 3 10 SNP 1 C C C G C SNP 2 A T T A A T Based on these results which SNP is best correlated with tail length SNP 3 C C C G C SNP 4 G G T T T GThe temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?Which of the following scenarios would ONLY occur if your skipped the digest purification step? UV/VIS spectrophotometric quantification of DNA may be skewed by uncut plasmid. Some plasmid molecules may be cut once, by one enzyme, and re-ligate to themselves. The fragments cleaved by the restriction enzymes on the plasmid and insert can re-ligate to their sites, causing reduced ligation efficiency. Plasmid molecules cut with EcoRI and Xbal can ligate to each other instead of the insert.
- Part A Which of the following statements concerning restriction enzymes is true? Select all that apply. ►View Available Hint(s) ☐ Restriction enzymes specifically target and cut RNA in a sequence-specific manner. Restriction enzymes occur naturally in viruses as a defense mechanism against bacteria. Some restriction enzymes generate overhangs in the target DNA sequence upon incubation. During a cloning experiment, the vector and target DNA should be cut with different restriction enzymes to ensure that sticky ends are generated. SubmitHow many statements are right? 1. operator is a protein (transcription factor) that interacts with a DNA sequence immediately downstream the promoter region 2. Type I restriction endonucleases cleave DNA at specific sites, close to recognition sequence 3. Type II restriction endonucleases cleave DNA within or at short specific distances from the recognition site 4. Type IIl restriction endonucleases Cleave DNA at random sites, cleave DNA near the recognition sequence 5. Type IV restriction endonucleases: Target only methylated DNA 3. 1 2. 4. 5.(i) Which of the DNA sequences shown below can be cut by using restriction enzyme? Explain your answer by analysing the sequences. Sequence A: 5'-AATGGCTGCCGTGGCTTA-3' Sequence B: 5'-TAACCCTGCGCATTTGCA-3' (ii) Given a DNA sequence, 5'-TACGAATTCGTAA-3' and EcoRI cutting site as below. Write out the double stranded fragments that are generated when EcoRI works on this DNA sequence. EcoR I 5.. GAATTC...3' 3...CTTAAG...5'
- A more modern molecular technique to RFLP fingerprinting is called Amplified Fragment Length Polymorphisms (AFLPs). In AFLP analysis, restriction enzymes are again used to digest genomic DNA into multiple fragments. Next, adapters complementary to restriction site overhangs are ligated to the fragments using an enzyme called DNA ligase. These adapters are complementary to primers used to amplify the fragments using the polymerase chain reaction (PCR). Can you think of any potential benefits of AFLP analysis over RFLP? Explain your reasoning.The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction fragments A, B, and C. Which of the gels produced by electrophoresis best represents the separation and identity of these fragments? Reminder: a positive electrode is located at one end of the gel and the negative electrode at the other end. II O a. From the positive to the negative end, the order of the fragments will be B, A, C O b. From the positive to the negative end, the order of the fragments will be A, B, C O c. From the negative to the positive end, the order of the fragments will be B, A, C O d. From the positive to the negative end, the order of the fragments will be C, A, B O e. From the negative to the positive end, the order of the fragments will be A, B, C#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?