How does the mRNA Covid Vaccine work? Can it get into your DNA? What other mRNA vaccines have we been working on?
Q: Peptides and small proteins fold spontaneously in aqueous solution…
A: Introduction : Entropy is the measure of randomness of any system. Similarly here we are taking…
Q: CH;OH H ÓH H H OH ČH,OH H ÓH
A: Polysaccharides are made of monosaccharide units linked together by glycosidic linkages.
Q: Humans can digest starch, maltose, sucrose and lactose but not cellulose. What structural feature do…
A: Starch, maltose, sucrose, lactose, and cellulose are examples of carbohydrates. Carbohydrates act as…
Q: Calculate the energy required for, or released in, a transport of 20 Na+ ions and of 100 molecules…
A: For a uncharged species, only its chemical potential gradient (i.e. concentration gradient) across…
Q: dentify any five junk foods you have taken from the last weekwhat lind of good foods can be the…
A: Introduction: A healthy diet is one that helps us to maintain or improve our health. It is necessary…
Q: b) Determine which ionization state corresponds to aspartic acid (shown below) at pH 1, 7, and 10 by…
A: Due to the presence of ionizable groups, the amino acids possess different charges at different pHs.…
Q: Question 2 What can we most-accurately say about the polypeptide with the primary sequence KNEADING?…
A: The amino acids are classified on the basis of polarity of the side chain into nonpolar and polar.…
Q: 3. What is the essential structure of a non-reducing sugar that stops it testing positive to…
A: Sugars are classified as reducing sugars and non reducing sugars based on the presence of free…
Q: F2 generation of plants have purple flowers of plants have white flowers Which plants in this figure…
A: Introduction: An allele is a pair of genes (section of DNA). The pair of alleles can be either…
Q: For each of the heterocyclic bases, choose a correct characterization from the response list…
A: Nucleic acids are the polymer of nucleotides. Nucleotide is made up of ribose or deoxyribose sugar,…
Q: 7. Complete the table below. Catabolic Function Disorder/Disease due to hormone abnormal activity
A: Catabolism is a group of metabolic pathways that break down molecules into smaller units, which are…
Q: Indicate whether the following compounds is positive or negative in the Benedict’s test: 1.…
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and…
Q: External ophthalmoplegia is associated with which deficiency? Group of answer choices Fumarase…
A: External ophthalmoplegia is a disorder that is caused due to mutations in mitochondrial DNA and is…
Q: Chemistry A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by…
A: [P] + [L] → [PL] Dissociation constant, Kd = [P] [L] / [PL] Dissociation constant (Kd) - is…
Q: QUESTION 28 All of the following statements about the Illumina (reversible terminator) process for…
A: Next-Generation sequencing also called high throughput sequencing or second-generation sequencing or…
Q: 4. Tourists were cast away on a descrted island and were starving lor a week. None of them developed…
A: Since you have posted a question with multiple sub-parts, we will answer the first 3 sub-parts for…
Q: 1. What is metabolism? 2. What are the two types of metabolism? 3. Which metabolic reaction requires…
A: Answer 6- CATABOLISM
Q: Compound X is an inhibitor in respiratory electron transfer. It binds to the Fe3+ of Complex IV…
A: Complex IV is the terminal electron acceptor in the electron transport chain (ETC). ETC is an…
Q: Te ing Comme deptn pndat AiyiCoA Ceel c gae thpral nd Co Figure 10.2.2 Stages of Catabolism (Taken…
A: Kreb cycle/ citric acid cycle / tricarboxylic acid cycle is the common pathway of degraded complex…
Q: Enzyme X has a Km of 2 µM and a kcat of 104 s1. In the presence of an inhibitor, Km increases to 4…
A: Enzymes are protein molecules that speed up the reactions by decreasing the activation energy.…
Q: 2 A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by ligan by…
A: The formation of an enzyme-substrate complex is the first step in enzymatic catalysis. The enzyme…
Q: Explain why glucose delivery is essential to health: The Impact of Diabetes.
A: Glucose is an essential metabolite which provides energy to a cell. The metabolism of glucose inside…
Q: Dilution Experiment Test tube Starch concentration (/mL) Dilution factor Observation 1 500…
A: Iodine test is a chemical test that distinguishes mono- or diaccharides from polysaccharides.
Q: i need the answer quickly
A: Theophylline is a metabolite which is present in tea. There are various other metabolites which are…
Q: ow many grams of a 1:3 mixture of glucose/glycerine would be required to make 2000mL of water…
A: Glucose is an essential component of the body and is known as blood sugar. Glycerin is used as a…
Q: BSA (mg/ml) Absorbancy 540nm 0.158 1 0.210 2 0.260 3 0.305 4 0.360 5 0.410 0.455 7 0.510 8 0.530…
A: The determination of protein concentration is a fundamental technique in biochemical analysis.
Q: ATP works in conjunction with motor proteins (such as cytoskeleton proteins) to make them move by
A: ATP works in conjunction with motor protein in order to make them move by binding with ATP to…
Q: | Explain how enzymes increare the peed of reaction Explain the most important reason why enzymer…
A: Hi, Thanku for the question. According to the company guidelines ,we can only solve 1 questions at a…
Q: 9. Ethanol is oxidized to acetaldehyde in the liver cytoplasm by _____.
A: Oxidation of ethanol produces acetaldehyde it occurs in the liver cytoplasm. Acetaldehyde is…
Q: Question 13 Lantus differs from "normal" insulin in that: Select one: O a. The usual insulin…
A: Insulin is a hormone that our body synthesizes in order to keep our blood glucose levels within the…
Q: 6. The five steps involved in conversion of pyruvate to acetyl-CoA are listed below. For each step,…
A: The glucose molecules are metabolized through the glycolytic pathway to synthesize energy (ATP and…
Q: 2. Which of the following statements is TRUE about phosphofructokinase-1? Select one: a. It is…
A: Phosphofructokinase 1 (PFK1) is one of the three regulatory enzymes of the glycolytic pathway. PFK 1…
Q: Describe what would happen to the lac operon in a low-lactose environment and in a high lactose…
A: LacZ (encodes beta-galactosidase), lacY (permease), and lacA (trans-acetylase) are the three genes…
Q: 2. In the sports camp, a group of students have been intensively swimming in a pool for 60 minutes…
A: The meal consist of carbohydrate, proteins and fats. The digestion of carbohydrates starts from the…
Q: 15 14 13 12 11 1.0 0.9 0.8 0.7 0.6 05 0.4 0.3 02 0.1 00 0.0 0.1 0.2 03 0.4 0.5 0.6 0.7 08 09 10 11…
A: Quantitative analysis helps to determine the unknown concentration of a substance in solution.…
Q: 4. Draw the two monosaccharides that will result from the hydrolysis of sucralose, artificial…
A:
Q: e Galapagos islands over four generations. How can you explain this ta using your knowledge of…
A: In Galapagos island, these finches (Darwin's finches) adapted various beak sizes depending upon…
Q: Why is it that the secondary messenger system is named as such? What is the two most common…
A: Cell signalling pathways help in communication between the cells and the surrounding environment.…
Q: dentify and describe how you would PEGylate this peptide at its N- terminal amine. Discuss the…
A: The process of PEGylation improves drug solubility and decreases immunogenicity of a molecule that…
Q: Amylose is comprised of glucose monomers connected by what kind of glycosidic bond? a (1 -->4) a (1…
A: Introduction: Polysaccharides are polymeric carbohydrate structures, formed of repeating units that…
Q: 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The genetic code is a set of three-letter combinations of nucleotides that corresponds to a specific…
Q: Enzyme involved in the second step of ketogenesis
A: Ketogenesis is the formation of ketone bodies (β-Hydroxybutyrate and acetone) from acetyl-CoA.
Q: Hormone Inactive adenylyl cyclase GTP Target cell GDP Blood vessel a Subunit of G, protein 3…
A: Metabolic regulation: Energy production or the synthesis of various end products to meet the energy…
Q: fill in the blank Alanine can enter gluconeogenesis as an alternative carbon source for glucose as…
A: Gluconeogenesis (GNG) is the process of synthesis of new glucose from non- hexose (or…
Q: Show a(１３：1)Cis Fatty-acid that is △^10 and what it is called in Omega No man clay.tur. Compared to…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Show the complete reaction mechanism for the deamination of alanine until the amino group is…
A: The deamination of the alanine amino acid takes place with the help of the transaminase enzyme to…
Q: recipitin test is typically performed to identify the origin of blood. What are the advantages of…
A: Precipitin test is considered as an optimal test to determine the origin of species from the blood.…
Q: 1. Describe the reactive part of each of the following coenzymes and the way each participates in…
A: Metabolic pathways are a cycle that occurs step by step in cells. Metabolic pathways include various…
Q: Briefly discuss how SLBs may be used to study drug-membrane interactions.
A: Lipophobic / Hydrophilic drugs cannot pass the Lipophilic/hydrophobic phospholipid bilayer of cells.…
Q: you add &ml of baderial Suspensfon ath Concentration water 2x1d cellolmi to13 ml what is the new…
A: A serial dilution of a bacterial culture is the stepwise dilution of the culture in which the…
Chemistry
How does the mRNA Covid Vaccine work?
Can it get into your DNA?
What other mRNA vaccines have we been working on?
Why do we need the vaccine EVEN though people can still get Covid?
Be sure to link references.
Step by step
Solved in 2 steps
- Hello, is this correct? What would a scientist need to use CRISPR-Cas system to introduce a specific point mutation into a gene? Check All That Apply Cas1 geneCas1 gene Cas9 geneCas9 gene sgRNAsgRNA donor DNAdonor DNA bacteriophage DNAEhat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatgHow would you go about cloning this amplified DNA into pL4440？Using your knowledge of cloning describe 5 important aspects of the method in details
- EcoRI recognizes GA-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? -'3 5'-AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCCYes or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr generate linear moleyof dna? in situ hybridization reveals distribution of a gene's mrna in an organism.Im designing a restriction cloning experiment. My professor said that plasmid and insert DNA work best in a 1:1 ratio. If my reaction does not work the first time I perform it, how would I ensure that the cause was the difference in concentration of reagents and how would I fix it so that the I have the correct concentration? If a restriction cloning experiment does not work, how could I be certain that it was due to an incorrect ratio of plasmid:insert and how can i fix this?
- A number of advances have been made in biotechnology. CRISPR/Cas9 one of the most controversial, and has had a lot of media attention in recent years. It is a method by which scientists can precisely edit DNA sequences at exact locations. Benefits obviously include the potential to “repair” mutated genes that cause disease. In fact, preliminary results from one of the earliest clinical trials of CRISPR/Cas9 provide evidence that the technique is safe and feasible to use for treating human diseases. What other potential applications of this application do you see (you can use any organisms to illustrate your answer)? What are the potential dangers or downsides of using this technology? Do you think this technology should be used in gene editing in humans? Explain your stance.12e which genes that are normally found in a lambda genome would be deleted in your lambda vector? briefly explain why those lambda genes are normally delete it from your lambda phage being used as cloning vectors.LO65 Compare methods that Covid tests and Covid vaccines use. What should the mRNA molecule of a regular mRNA vaccine contain to be translated accurately by our cells? a-Manking UTRS b-alternative codont c-DNA template strand d-promoter e-poly A tail f- S cap asap please
- n your experiment there will be 4 different experimental samples labeled A-D (please see Table 3 on page 12 of the Lab 4 handout). In sample D, if you saw some bacterial colonies that are blue and some colonies that are white, what would this tell you? Group of answer choices the sgRNA was completely non functional the CRISPR/Cas9 donor DNA repair is not 100% efficient there is no functional lacZ on this bacterial plate arabinose was not active on this bacterial plateZFNs What is it? And how it works in genome editing? Including additional figures pls At least 1-2 pageEcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
