Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' 1. Where N stands for any nucleotide, give the complementary MRNA sequence. Indicate direction of strand as 3'--> 5' or 5' --> 3' as in the given sequence above. 2. Give the amino acid sequence of your mRNA sequence in No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter names of amino acids separated by a hyphen (-), no spaces in-between. 3. Assuming that the DNA codes for 20 amino acids, where each amino acid is coded by 3 nucleotides each. What is the length of the DNA if 1 turn made up of 10 nucleotide base pairs measures 34A?
Q: Why is there some signal present within the ‘no sugar’ and other noninducing sugars for the green…
A: The L-arabinose operon, commonly known as the ara operon, is a gene sequence that encodes enzymes…
Q: Please give information and explain the modeling of cancer with IPS cells (induced pluripotent stem…
A: The discovery of iPS cells opens up a wide spectrum of possible future applications including…
Q: How does the respiratory system work with the circulatory system?
A: Respiratory system and Circulatory system The respiratory system includes A pair of lungs and the…
Q: II. A 45-year-old man complained of rapid weight loss, tachycardia, increased swcating, occasional…
A: * A 40 years man have rapid weight loss and tachycardia and increased sweating and occasionally…
Q: What is the equilibrium membrane potential due to Na+ ions if the extracellular concentration of Na+…
A: Nernst equation calculates the voltage necessary to perfectly oppose the net movement of an ion…
Q: Tumor Necrosis Factor : they are lymphocytes arise from the lymphoid organs(bone and thymus) but…
A: Innate immunity is the immunity that we are born with and is present by birth. while adaptive…
Q: Changing the shape of the pinnae disrupts a. binaural cues b. interaural level difference…
A: Introduction The ear is an organ that allows humans to hear and, in mammals, to maintain body…
Q: A mushroom is______ . a. a fungal digestive organ b. the only part of the fungal body made of hyphae…
A: Introduction :- Fungi are what mushrooms are. They belong in their own realm, separate from plants…
Q: Of all the parasitic insects discussed herein (endoparasites, ectoparasites, mallophaga, anoplura,…
A: Introduction :- Parasites are the organism's which lives at the body surface or inside the body of…
Q: Q.14.How is Biotechnology useful in developing food crops and in agriculture process
A: Agricultural biotechnology encompasses a variety of strategies, includes conventional breeding,…
Q: OLD DNA NEW DNA mRNA PROTEIN STRAND STRAND NAME REPLICATION TRANSCRIPTION TRANSLATION CGT AGC TGC 1…
A: DNA ( Deoxyribonucleic acid) is a two stranded , helical structure present inside the nucleus of the…
Q: 4. During a lunch at a McDonald's outlet, an office employce received about 350 g of carbohydrates…
A: In the liver, the basic process of carbohydrate and lipid metabolism are: Carbohydrate metabolism:…
Q: In most_______ , an extensive dikaryotic mycelium is the longest-lived phase of the life cycle. a.…
A: Introduction :- A single spore germinates as a monokaryotic mycelium, which cannot reproduce…
Q: Green filamentous Slime molds Fungi Animals Entamoebae Gram+ bacteria Animals Spirochetes Chlamydiae…
A: Phylogenetic tree is the representation of how organism evolves from a common ancestor.
Q: a) What is the consequence of discharging larger volumes of sewage that is untreated into a river?…
A: a) If untreated water is dispensed directly into rivers, it will result in adverse water pollution…
Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…
A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…
Q: Aphids are insects that feed on tomato plants. If you want to save your tomato plants from the…
A: Ecology is the study of the interactions between organisms and their surroundings, whereas…
Q: Given: Father - heterozygous for the H locus of the H antigen, heterozygous for the B locus of the…
A: Introduction Homozygous means that you inherit the same version of the gene from both parents,…
Q: Discuss the ecological importance of tapeworms.
A: Answer
Q: E.coli phage T4 DNA is terminally redundant and ____________________. A. linearly permuted B.…
A: 1. The correct answer is option B- circularly permuted. E.coli phage T4 DNA is terminally redundant…
Q: compare and contrast the theory of ecological community and population genetics.
A: The two different levels of ecology are 1. Population 2.Ecology Population ecology refers to the…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: Carbohydrate catabolism is a process of breakdown of carbohydrates to provide energy in the form of…
Q: Draw and label parts of whole mount specimens of the following stages: Primitive Streak Head…
A: The development of the chick begins in the single cell formed by the union of two parental cells,…
Q: Discuss the genetic engineering of nodulation genes and the molecular events that occur during…
A: * Nodulation is an host specific process where rhizobium will be having a defined host plant range.…
Q: hand draw the phosphate cycle with detailed annotations
A: The phosphorous cycle is a biogeochemical cycle that deals with the movement of phosphorous in the…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: Fat metabolism is a very complex process and there are various metabolic pathways through which fat…
Q: Q.4. Describe the kind of food that would have lactic acid bacteria. Mention their useful…
A: Lactic acid bacteria are probiotic organisms, commonly used in fermented dairy products. They…
Q: The protective layer of cells found on leaf’s upper and lower surfaces is known as the __________.…
A: The leaf of the plants are mainly specialized for performing the photosynthetic roles.…
Q: the differences between THT and SMT PCB fabrication
A:
Q: You want to find a drug which inhibits this calcium response pathway in normal cells where it is…
A: Cell signalling, also known as cell communication, is a cell's ability to receive, process, and…
Q: Picking up a pencil requires what kind of stimulus to a muscle? OSub-threshold stimulus O Threshold…
A: Introduction :- Skeletal muscle is a type of striated muscular tissue that is directly controlled by…
Q: Mark all on the following list that must occur for auxin to promote gene expression. ARF proteins…
A: These are the questions related to plant physiology and their biochemical reactions which causes…
Q: 16. Eukaryotic initiation factor elF2B is a guanine nucleotide exchange factor. Explain why elIF2B…
A: The eukaryotic initiation factor elF2B is the guanine nucleotide exchange factor, which converts…
Q: 1) Please examine the figure below, depicting a portion of the rete mirabile associated with the gas…
A: A rete mirabile is a complex of supply routes and veins lying exceptionally near to each other,…
Q: Once an organisation’s mission has been established, it can begin to identify its strategy and…
A: Introduction An organisation, or organisation is a one- or multi-person body with a specific goal,…
Q: Q.2. What is a bioreactor? Explain different types of bioreactors.
A: Introduction Living things or bio means of life. A biography is a type of bio that gives an account…
Q: Know examples of gymnosperm families that have the following characteristics: fleshy, drupaceous…
A: “Fruits” of Cephalotaxus fortunei (Cephalotaxaceae) There are 4 major gymnosperm lineages on…
Q: in your own words: Some insects parasitize other insects. These are known as parasitoids. Select…
A: As stated parasitoids are the group of parasites that reside inside the host insects. The…
Q: Organisms made during reproductive cloning will have the same genetic and personality traits of the…
A: Cloning is a process which has been used in biology for a long time to study various elements of the…
Q: Q.14.How is Biotechnology useful in developing food crops and in agriculture process
A: Biotechnology has a wide range of applications in agriculture and the development of food crops, and…
Q: How was the level of danger defined in the Copenhagen Accord? a. global temperatures rising more…
A: Copenhagen summit was held on December, 2009 in Copenhagen. The outcome of this summit was a…
Q: Show the cross between a pure breeding dominant tall pea plant and a short plant.
A: * cross between a pure breeding dominant tall pea plant and a short plant. * Here the Dominant…
Q: What is the gravity receptor involved in gravitropism?
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: What is the color of the visible light that is not utilized in photosynthesis? Select one: a.…
A: Pigment molecules are the organic molecules that are involved in absorption of light energy ( from…
Q: Q.19. List a few examples of biofortified crops. How do they benefit society?
A: Biofortification also known as biological fortification is a bio technique that implicates the…
Q: Tasmanian devils became extinct on the mainland of Australia probably because of competition for…
A: Species is a group of individuals that can mate together and produce viable offsprings.
Q: Briefly explain why this is ELISA referred to as colorometric assay.
A: The most important of the immunoenzyme assays are the Enzyme-linked immunosorbent assays, commonly…
Q: Use the illustration below to answer the question. Crocodilians Dinosaurs Birds According to the…
A: The phylogeny of crocodiles, dinosaurs and birds is given in the question.
Q: Which of the following links the Innate immune system to the adaptive? a. Cytokines b. APC cells c.…
A: INTRODUCTION Antigen presenting cells This is atype of phagocyte. These cells shows antigens on…
Q: Which of the answer choices is true about ATP synthase? Select all that apply. O ATP synthase makes…
A: *ATP synthase is a enzyme present in mitochondrial inner membrane and catalyzes the synthesis of…
Please help me, thankyou
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
- 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G