Frameshift Insertion Mutation – Can be one or more nucleotides. 5’ ATG GGG AAA GAT TAT TAG 3’ (non-template strand) 3’ TAC CCC TTT CTA ATA ATC 5’ (template strand) What is the resulting mRNA sequence now? What is the resulting amino acid sequence now?

Frameshift Insertion Mutation – Can be one or more nucleotides. 5’ ATG GGG AAA GAT TAT TAG 3’ (non-template strand) 3’ TAC CCC TTT CTA ATA ATC 5’ (template strand) What is the resulting mRNA sequence now? What is the resulting amino acid sequence now?

Name: Frameshift Insertion Mutation – Can be one or more nucleotides.5’ AT
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Frameshift Insertion Mutation – Can be one or more nucleotides.5’ ATG GGG AAA GAT TAT TAG 3’ (non-template strand)3’ TAC CCC TTT CTA ATA ATC 5’ (template strand) What is the resulting mRNA sequence now? What is th

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids The section of a gene shown above (AAG ATA CAG GCT CGG TAA) is called the Answer (template or non-template) strand. It is also known as the Answer (sense or antisense) strand. The amino acids are determined from the Answer (DNA or mRNA or tRNA) strand
What are the correct codons of the MRNA from the given DNA strand that needs to be transcribed? * Sense strand 5' AAT GCC AGT GGT3' Antisense strand MRNA 000 000 TRNA (anticodon) Figure 1. Amino acid (peptide) 3' TTA CGG TCA CCA 5' 5' TTA CGG TCA CCA 3' 3' UUA CGG UCA CCA 5' 3' AAU GCC AGU GGU 5'
The following DNA sequence occurs as the template strand: 3’ – TACGGGGATCAGATTATC – 5’ DNA template What single nucleotide deletion within the DNA sequence would cause a frame shift and a premature STOP codon? Write down the sequence of the New DNA template after deletion of the single nucleotide and also that of the New mRNA transcript, and specify the 5’ and 3’ ends of both the template and the mRNA transcript. Highlight the premature stop codon in the mRNA transcript.
Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'
thank you
What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is needed
A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOP
3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence transcribed from template?Amino acid sequence of peptide?and Type of mutation?
LIAINAS SA4) Fill in the missing DNA, MRNA, anticodon and protein sequence. A codon table is available at the end of the exam. Make the anticodon complementary Template strand 3' T_A G _C 5' Non Template 5' ACA -- 3' MRNA 5' 3" Anticodon 3' 5' Protein Thr Arg in in
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G