What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? * Sense atrand 5' AATGCC AGT GGT3' 5' Antisense strand MRNA |3' TRNA (anticodon) Figur Amino acid (peptide) 3' TTA CGG TCA CCA 5' 5' TTA CGG TCA CCA 3' O 3' UUA CGG UCA CCA 5' 3' AAU GCC AGU GGU 5'
Q: Using the 5 major steps, make or create your own flow diagram of the genetic engineering process
A: Flow diagram of genetic engineering processes :-
Q: Question 7. When does differentiation occur in egg development?
A: Cellular differentiation is a multi-step process involving the coordinated regulation of genes by a…
Q: Choose the correct answers. Q1: It is a practice of making hypotheses about taxonomic…
A: DISCLAIMER "Since you have asked multiple questions, we will solve the first question for you. If…
Q: Which of the following factors is the least important when the physician prescribes an antibiotic to…
A: To make sure the treatment and dosage is safe, the healthcare provider must consider some factors.…
Q: Give example of 2 animal hybrid species and provide details on parental species, reason for…
A: Hybrid species and their significance to the society.
Q: Why is the epithelial tissue characterized as polar sheets? answer and explain
A: INTRODUCTION Tissues are the groups of cells that perform a particular or similar function in the…
Q: Because of the naturally-existing regulation mechanisms of the cell, injecting double- stranded RNA…
A: Usually the RNA is single started molecule. It is synthesized with the help of template DNA and it…
Q: If GTP hydrolysis occurs on a tubulin molecule at the plus end of a microtubule filament before…
A: Tubulin makes up microtubules, which are the cytoskeleton's most important component.
Q: Question 1. All of the following events occur luring anaphase EXCEPT DNA replication the separation…
A: The main activities occur during anaphase: -Each chromosome's sister chromatids disengage from their…
Q: How does the process of DNA replication generate mismatch mutations? What mechanisms are available…
A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.
Q: An antimicrobial agent shows selective toxicity when specifically: An antimicrobial agent is said to…
A: Bacteria, viruses, and other microorganisms are everywhere in the environment. They are even inside…
Q: You have the following sequence reads from a genomicclone of the Drosophila melanogaster genome:Read…
A: An organism's genomic sequence is defined as the sequence of nucleotides that make up a DNA…
Q: is Alzheimer’s disease and why is it bad ?
A: Alzheimer's disease is a progressive neurologic disorder that causes the brain to shrink (atrophy)…
Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…
A: Reproduction It is a process leading to the formation of an organism that may or may not be similar…
Q: < CO A Moving to another question will save this response. Question 25 Which statements in incorrect…
A: The endocrine system collaborates with the neurological system to keep the body in a state of…
Q: Imagine that the digestion of a meal has just provided a newsupply of glucose and amino acids in…
A: Introduction Digestion is the process of breaking down large insoluble food molecules into smaller…
Q: Blood group B has B antigen on the red blood cells with anti-A antibodies in the plasma. True False
A: Introduction:- Although there are numerous techniques for grouping blood types, the ABO system is…
Q: In an in situ hybridization experiment, a certain clonebound to only the X chromosome in a boy with…
A: In situ hybridization is a sort of hybridization in which a labelled complementary DNA, RNA, or…
Q: After you complete an assessment of a patient in a clinical area or in a simulation laboratory,…
A: There are few important points about an assessment of patient in a clinical area and main points…
Q: What are the fundamental properties that characterize living things and distinguish them from…
A: Introduction :- A cell (or cells) is the building block of all living organisms.To exist, they must…
Q: Virology: What is the Baltimore classification of Influenza Viruses and what does this mean ?
A: Answer
Q: What is represented on the image above? (A) A cross-section of a cardiac muscle B A longitudinal…
A: Introduction Muscles are soft tissues, Many, stretchy fibers make up our muscles, muscle is a group…
Q: Which of the following is a characteristic or criterion used to evaluate an antibiotic? The answer…
A: Antibiotics are a class of chemical compounds that destroys or retards the growth of Microorganisms.…
Q: can you Illustrate and explain a back crossing
A: Backcrossing can be defined as a crossing of a hybrid with one of its parents or with an organism…
Q: Identify the probable causes of spoilage in canned food
A: Probable causes of canned food spoilage.
Q: Briefly explain the rationales of adding chemicals which can affect DNA stability in polymerase…
A: PCR is used for DNA fingerprinting, to identify an individual from blood or tissue left at a crime…
Q: Mutations are mistakes in the dna that change the genetic plan from the previous generation. imagine…
A: Making a biological structure is far more complex than making a shoe, still for the purpose of…
Q: arasitic organisms do you consider beneficial? F
A:
Q: how many tetrads are present in a primary spermatocyte undergoing synapsis? a. 23 b. 44 c. 22
A: Meiosis division is a kind of cell division that results in the formation of haploid sex…
Q: List the evidences of evolution that philippine tarsier is an endemic species.
A: Philippine Tarsiers are basically haplorrhine primates which belongs to the family Tarsiidae.…
Q: 1. After receiving the SR signal, stem cells in the developing organism will have an increased…
A: Gene is unit of DNA that is usually located on a chromosome and that controls the development of one…
Q: Mention the important characteristics of coelenterate and give examples
A: Coelenterate Classification: Kingdom: Animalia Subkingdom: Eumetazoa Phylum: Coelenterate They…
Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…
A: The nervous system is the body's command room. Starting from the cerebrum, it controls developments,…
Q: Why are mutations in the INK4 locus so dangerous?
A: INK4 is a cyclin-dependent kinase inhibitor family (CKIs). Inhibitors of CDK4 and CDK6 are…
Q: Question:- Cells need a way of counting how many divisions they have undergone to keep track of…
A: The majority of replication errors are fixed during replication by DNA polymerase or by…
Q: Which of the following statements is true about the protein Cytochrome C? Its secondary structure is…
A:
Q: Figure 3. This image corresponds to question 18. 18.b What is taking up the majority of the space in…
A: Normal human adipose tissue Adipose tissue, body fat, or simply fat is a loose connective tissue…
Q: Using the 5 major steps, make or create your own flow diagram of the genetic engineering process…
A: Flow diagram of genetic engineering process.
Q: What is a species, according to the biological species concept?
A: Introduction:- Geographic isolation is a common mechanism for the speciation process to get started.…
Q: Figure 7. This image corresponds to question 22. 22a. What is the tissue type? 22b. What are the…
A: Introduction Tissue is a collection of cells with similar structures that work together as a unit.…
Q: Describe how mutations in genome maintenance factors promote tumorigenesis. Why would inactivation…
A: The cells are basic units of life. When any mutation in the gene takes place due to any radiation or…
Q: Mention and describe the two types of bacterial resistance to antibiotics.
A: The emergence of resistance among the most essential bacterial pathogens is recognised as a main…
Q: Select 2 types of platyhelminth and describe the following: class characteristics development
A: * platyheminthis called flatworm which are flattened invertebrates containing soft body *Most…
Q: In the chapter-opening photograph of kernels on an earof corn, what is the genetic basis of the…
A: Part a.The fully pigmented kernel has resulted from the wild-type copy of the C gene expressed in…
Q: Think of at least 1 way on how to lower the birth rate in the Philippines. Discuss briefly.
A: Though there are many strategies by which we can lower the birth rates. I am sharing best of two…
Q: How many restriction sites does each enzyme have? Restriction Fragments generated Number of sites…
A:
Q: Select 2 types of mesozoans and describe the following: class characteristics developments
A: This question is about mesozoans.
Q: What can you do to maintain the balance of the different biogeochemical cycles
A: Biogeochemical cycles- biogeochemical are the cycling of chemical elements between living and…
Q: utline the basic steps in canning. Discuss each briefly
A: Introduction Canning is an important, safe method of food preservation by storing it in containers…
Q: If all copies of a given locus have the same allele throughout the population, the allele frequency…
A: The relative frequency of an allele at a given locus in a population, represented as a fraction or…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps with 1 images
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- What is the amino acid sequence of the peptide that would be synthesized after transcription and translation of the following piece of template strand DNA? 5' 3' codon translations _________________________ codon amino acid T C A T G C G C A A C A AGU Ser ACG Thr CGU Arg UGU Cys UGC Cys GCA Ala UGA stopThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYGiven Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:
- The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.