(ol soupe bannos96 SAM 3A small strand of DNA has this sequence: 0pxbeter owl nade hopargTACCGGAAACTGATGGCCTTTGACa. If the TOP strand is the template strand, what will be the mRNA madefrom this DNA read from left to right? What process allows for the mRNAto be made?b. If this is a eukaryotic mRNA, where does transcription occur? What wouldhappen if the mRNA was not processed?c. What is the sequence of the protein made (use the genetic code below)?What process allows for the protein to be made? FIRSTBASEUCSAGUniversal Genetic Code ChartMessenger RNA Codons and the Amino Acids for Which They CodeSECOND BASEUUUUUCUUAUUG}U}CUUCUCCUACUGAUUAUCAUAAUG }GUUGUCGUAGUGPHE}LEULEUILEMET orSTARTVALUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGCSERPROTHRALAUAU{}UACUAAA}UAGCAU}CACCALATA }AAUAACAAAAAAG^}GAUGACGAAGAGTYR}STOP} ASNLYSHISGLNASPGLUUGUUGC }UGACGUCGCCGACGGGUGG} TRPAGUAGCAGAAGGGGUGGCGGAGGGCYSSTOP}ARGSERARGGLYUCAGUCAIG5CAOАCAGUCAGTHIRDАBASE

Name: (ol soupe bannos96 SAM 3A small strand of DNA has this sequence: 0pxb
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: (ol soupe bannos96 SAM 3A small strand of DNA has this sequence: 0pxbeter owl nade hopargTACCGGAAACTGATGGCCTTTGACa. If the TOP strand is the template strand, what will be the mRNA madefrom this DNA read from left to right? What process allows for th

The central dogma of molecular biology is the sequence of information flow from DNA to RNA to…

Science

Biology

follost sirupe trono CRM A small strand of DNA has this sequence:expresow as hagalg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?

follost sirupe trono CRM A small strand of DNA has this sequence:expresow as hagalg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
thank you
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Give the single letter translation for the protein encoded by this mRNA. Start with the start codon. 5' M7GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGAAAA O ATDHXPTK OPTYMATDH MRAHVT O MATDH AAAAAA - 3'
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'