Dideoxy sequencing suitable for determining the sequence of one DNA molecule high error rate per sequence read Answer Bank typically results in sequence reads of about 500 to 1000 base pairs Next-generation sequencing suitable for sequencing an entire genome typically results in sequence reads of about 100 base pairs low error rate per sequence read
Q: Your internship with Dr. Nefario at Gru Industries is going well so far, but a recent mission to…
A: This question asks us to apply the principles of Mendelian genetics to a hypothetical situation…
Q: 2. The following DNA sequence corresponds to the complete coding sequence of a gene three-amino acid…
A: To obtain the anticodon sequences, we need to convert the complementary DNA sequence to RNA by…
Q: 8. Which of the following gene mutations is most likely to affect correct protein production? The…
A: A gene is a region in a DNA sequence that contains the information to be transcribed into RNA…
Q: A. The earliest evolutionary change in the hominins was a. increased brain size. b. habitual…
A: Evolution is defined as the process by which the an organism change through time as a result of…
Q: 1. Using the diagram below: a. Label the process identified by each arrow. b. Label the diagrams…
A: DNA stands for 'deoxyribonucleic acid'. It is the hereditary material in humans as well as in most…
Q: Bacteria exhibit drug resistance only by genetic means
A: Bacterial drug resistance refers to the ability of bacteria to withstand the effects of antibiotics…
Q: most affected by climate change
A: Climate change: It refers to the long-term alterations in the temperature patterns, precipitation…
Q: Explain structure and function causes of brain damage and neurological disease A brain tumor, known…
A: An intracranial tumour, sometimes referred to as a brain tumour, is an abnormal mass of tissue where…
Q: Which one below best describes the symptoms of dementia? Acute confusion and disorientation.…
A: Dementia is defined as a mental disease whereby a group of symptoms are observed which are affecting…
Q: PLEASEEE HELPP Compare 3 of Phyla (including Mammals) *minimum 4* Sponges Cnidarian Annelid Mollusk…
A: The biological world is undoubtedly characterized by a multitude of life forms, each with its own…
Q: Non-alcoholic fatty liver disease has been linked to high-sugar diets. Explain?
A: Non-alcoholic fatty liver disease (NAFLD) is a common disorder characterised by excess fat buildup…
Q: I am doing a research paper on H pylori for abriatric surgery. I need help with figuring out how it…
A: Helicobacter pylori (H. pylori) is a type of bacteria that can infect the stomach and the upper part…
Q: Question 7 In old movies, when the heroine becomes pregnant, a doctor bursts into the room and…
A: The question refers to an old-fashioned method of detecting pregnancy known as the "rabbit test".…
Q: Briefly summarize Dr. Barry Marshall’s experiment that showed that stress, spicy foods, and excess…
A: Dr. Barry Marshall is an Australian physician and researcher who gained international recognition…
Q: Here is my question for you: Protein called p53 is known to have a very important function is cell…
A: Tumour suppressor genes are a class of genes that help regulate cell growth and prevent the…
Q: Using one named example of an acquired cause of iron overload and explain how iron homeostasis is…
A: The body has limited mechanisms to eliminate excess iron, and the iron overload can gradually…
Q: Why is a second polar body expelled after fertilisation (select one) a. The oocyte must recativate…
A: The second polar body is a small, non-functional cell that is produced during oogenesis after the…
Q: In the pathological manifestations of intestinal and brain tissues in NEC neonatal rats section of…
A: The research study has been carried out for investigating the role of CXCL1/CXCR2 in mediating…
Q: What are the possible genotypes for the following wizards for the MC1R gene? I:…
A: Genetic Inheritance: The genes from parents regulating different traits are passed down to offspring…
Q: QUESTION 3 Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1.…
A: Transcription is the process by which the information in the gene is coded into a mRNA with the help…
Q: 1. Suppose that rabbits are the only prey and food supply of foxes, and that the predator-prey…
A: The Lotka-Volterra equations are a pair of differential equations that model the dynamics of…
Q: Which hormone is most like prolactin inhibiting hormone with respect to synthesis, signaling,…
A: prolactin inhibiting hormone, is a hormone synthesized and released by neuroendocrine cells in the…
Q: 2. Which of the following is correct? A. Vitamins are proteins synthesized by the human body and…
A: To carry out normal function of our body and to stay healthy our body need some micronutrients.…
Q: what hormone is involved in the stimulation of the male reproductive system, development of…
A: The male reproductive system is responsible for producing and delivering sperm for fertilization. It…
Q: 4. The life cycle of a mosquito depends on the availability of standing or slow-moving water. If…
A: Ecological adaptation refers to the process by which organisms adjust to their environment in order…
Q: As a cancer researcher, which segment of the signal transduction pathway would you target to prevent…
A: As a cancer researcher, targeting the signal transduction pathway can be an effective approach to…
Q: d. Mark the two DNA damage checkpoints e. Mark the chromosome alignment (spindle) checkpoint
A: Cell cycle defines the sequence of events that occur during cell division. There are different…
Q: Explain why vitamin K is important in the context of coagulation.
A: Coagulation, also known as blood clotting, is a complex biological process that helps stop bleeding…
Q: e. Mark the chromosome alignment (spindle) checkpoint
A: E. Check are present a different stages in the cell cycle so that the separation of chromosome…
Q: You will need to complete this question on a separate piece of paper. Scan or take a picture of it…
A: Logistic growth is the growth in population size with time and levels off when reaching a maximum…
Q: ernal appearance structure: rhizoids: 2 thallus: 3 mal
A: Marchantia polymorpha is a diecious plant. In this plant sex organ of male and female develop on…
Q: What will happen to the human immune system when a microorganism invading the body lacks the…
A: The immune system is a complex network of cells, tissues, and organs that work together to defend…
Q: Alleles that increase resistance to disease are expected to increase in frequency in the population…
A: An allele is a variant form of a gene that occurs at a specific location on a chromosome. Genes are…
Q: Will the plate count and direct count of the same milk approximate each other? Why or why not?
A: Food products like milk and other dairy products are very nutritive and hence prone to spoilage by…
Q: Which technique uses cDNA? Northern O DNA microarray Southern O DNA finger printing
A: cDNA stands for complementary DNA. It is a synthesized DNA molecule that is complementary to a…
Q: "The use or disuse of a trait explains why it evolved or was lost." Please explain in detail why…
A: In 1800s, Jean-Baptiste Lamarck, a biologist and a French scientist give his contribution in…
Q: 2. Write out the steps on how you would set up this experiment and collect data if you grew 15…
A: To do this type of experiment first clear these things. What are you being asked to do? What…
Q: A farmer growing maize in Eastern Cape under rainfed and marginal soils approaches you and tell you…
A: Grain sorghum can be a suitable alternative crop for the farmer's conditions due to its ability to…
Q: Here is a list of knockout gene mutations that are desired to make in E. coli genome. You should…
A: A number of knockout gene mutations in the E. coli genome are shown to us in this scenario. Each…
Q: how is homeostatic balance regained after exercise
A: After exercise the body undergoes various physiological changes to restore homeostatic balance.…
Q: Do your results conform to the proposed inheritance mechanism for these traits? Are there…
A: The question involves interpreting a table of data from a class experiment, which recorded various…
Q: Choose true or false for each of the following statements: A. Neanderthal DNA shows that they share…
A: Note:- Sorry, since you have posted multiple questions, we will be solving the first three for you,…
Q: 6. A deletion mutation occurs, leaving 92 bases in nucleotide sequence. What is the maximum number…
A: A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or stop…
Q: 5. Which end corresponds the last amino acid of a polypeptide chain? A. The 5' end of a DNA coding…
A: Proteins are made up of long chains of amino acids linked together by peptide bonds. The sequence of…
Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…
A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…
Q: Which of the following accurately describes a feature of normal occlusion in a dog or cat? a. The…
A: In cats and dogs, occlusion is an anatomic term used to describe the alignment of maxillary and…
Q: Amphioxus long has been of interest to zoologists searching for a vertebrate ancestor. Explain why…
A: Amphioxus, also known as lancelets or Branchiostoma, is a small marine animal belonging to the…
Q: Create a research hypothesis using the statement if the problem: Statement of the Problem This…
A: Mendelian Genetics is a fundamental concept in biology that explains how traits are inherited from…
Q: Discuss the differences between human and sheep parturition.
A: Parturition refers to the process of expelling out the fully developed fetus in the uterus of a…
Step by step
Solved in 3 steps
- Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGSecond Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original: AGAGAGAGAGAGAGAGAG Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His Mutated: AGAAGAGAGATCGAGAGA CUC CC CAC CGC Leu Pro Arg CỦA CCA CAA CGA Gin CUG CCG CAG CGG AUU ACU AAU AGU Ser Asn What amino acid sequence will be translated based on the AUC Ile ACC AAC AGC The mutated DNA? Hint* must transcribe and translate the AUA ACA AGA AAA arg Lys Met or Start AUG ACG AAG AGG mutated strand to find the answer. GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly G GUA GCA GAA GGA Glu GUG GCG GAG GG First Base Third BaseThe following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig?
- Repeated sequences can be classified according to theirorganization in the genome as well as according to theirfunction. Give at least two examples of each.A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the image below. Based on the band pattern observed here, write out the sequence of both the complementary strand generated during the experiment, and the template strand that is being analyzed. Be sure to clearly indicate the 5' and 3' ends of each. ddATP ddGTP ddCTP || | | ddTTP | 3' 5' Tyne a short answer in the space provided belowWhat is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that is most correct. The di-deoxy DNTPs are incorporated into the growing DNA molecule. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule, thereby creating fragments which all end in that specific di-deoxy base. Subsequent separation of the fragments by size facilitates the ascertainment of the sequence. The di-deoxy DNTPs facilitate polymerisation of the growing DNA molecule. this allows for multiple copies fo the template to be made for further analysis. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule. Ending the replication ensures that the molecules are not too long to be sequenced.
- A Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNAExamine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
- In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionIn a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strandGiven the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…