cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.
Q: Aminoacyl-tRNA synthetase joins amino acids to their cognate trna. Briefly discuss the two reactions…
A: Aminoacylation is mechanism of attachment of amino acid to tRNA. Aminoacyl-tRNA synthetase joins…
Q: Is it reasonable to expect that protein degradation can take place at any location in a cell?
A: Protein degradation is considered as the most important step in the cell, during which proteins are…
Q: Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: As a cell makes the transition from normal to malignant growth, there is increased dependency on…
A: Km value is numerically equal to substrate concentration at which half of the enzyme molecules are…
Q: Cyanobacteria are photosynthetic prokaryotes that are likely responsible for generating the gen-rich…
A: Answer :: An alternative pathway for glucose oxidation is the pentose phosphate pathway (PPP). In…
Q: Briefly (list in bullet points) what are the FIVE stages of Protein synthesis. Why do you suppose…
A:
Q: In the Lysozyme purification, if the specific activity in the elate was 108 units/mg and the…
A: Egg white is generally rich in lysozyme and hence it is used for its purification. Lysozyme provides…
Q: 12. RNase A is a ribonuclease enzyme that degrades single stranded RNA. There are three key amino…
A: RNaseA catalysis is a typical example of acid base catalysis. Histidine is a common amino acid in…
Q: Consider the hypothetical serine protease, which shows the specificity pockets. The S, pocket has a…
A: Serine proteases are a family of enzymes that are capable of cleaving peptide linkage of proteins.…
Q: Approximately how many nucleotides make up the ATP6 gene? What are the first three nucleotides…
A: Genetic codes are made up of specific nucleotide sequences. Genetic codes are unique for each…
Q: Please select appropriate word in each bracket Many anti-cancer drugs affect nucleotide metabolism…
A: Nucleic acid metabolism refers to the set of reactions that are responsible for synthesis and…
Q: Pol l is proteolytically cleaved to yield the which lacks 5¢®3¢ exonuclease activitycontains partial…
A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…
Q: Suggest a reasonable strategy for the specific phosphorylation of the 5’ –OH group of a nucleoside.
A: Nucleosides are glycosylamines. They are basically nucleotides devoid of a phosphate group. It…
Q: Enzymes involved in the synthesis of tryptophan in bacteria is an example of Constitutive.…
A: Tryptophan is an energetically high-priced amino acid to manufacture, which makes it a crucial…
Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…
A: The mutation is a process that causes changes in the DNA sequence and that effect the amino acid…
Q: In humans, sickle-cell anemia and hemophilia represent which type of mutations? Loss of…
A: Mutations are of different types. Mutations are change in the sequence of DNA which may cause the…
Q: Explain the significance of the following statement: The functioning of the aminoacyl-tRNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Posttranslational modifications serve several purposes. Discuss and give examples
A: When the proteins are synthesized then these proteins undergo posttranslational modifications.
Q: I have this strain of e coli. Is P+ o+ Z+ Y+ / I- P+ oC Z- Y+ Will beta-galactosidase and…
A: Lac operon constitutes a set of structural genes regulated by a common promoter in bacteria.
Q: Biotransformation. Explain the process of enzyme induction. What are the benefits or down-falls of…
A: Enzymes are proteins that increase the rate of chemical reactions by lowering the activation energy…
Q: You are studying a bacterial metabolic pathway that results in the synthesis of a product, vitalin,…
A: Given information: Bacteria has metabolic pathways that helps in synthesizing the product vitalin,…
Q: Consider protein degradation in the absence of ubiquitinylation. Is the process likely to be more or…
A: Ubiquitinylaton is the process of the addition of a protein called ubiquitin to the substrate…
Q: Pol II is active when its tail is phosphorylated. Which of the following amino acids is present in…
A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group…
Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…
A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…
Q: Choose the correct option for following three mcqs 7.The first step in the capping reaction is…
A: Introduction: The correct choice is "phosphatase". The correct choice is "RNA polymerase-II". The…
Q: Several temperature-sensitive mutant strains of E. coli displaythe following characteristics.…
A: Okazaki fragments are produced during the replication of lagging strand in semi-discontinuous…
Q: The cyanobacterium Oscillatoria sancta appears reddish-brown when grown under green light but alters…
A: Cyanobacterium oscillatoria Sancta belongs to the genus of cyanobacteria. The organism is a large…
Q: In the serine protease triad, the proximity of an aspartate carboxylate group of histidine raises…
A: Serine protease is a class of proteolytic enzymes in which serine residue is present at the active…
Q: Once the chains of peptides that make up lysyl-tRNA synthetase protein are synthesized in ribosomes,…
A: Protein folding is the process where the proteins fold themselves to come to their native form. This…
Q: Site-directed mutagenesis of enzyme active site explained
A: Oligonucleotides are generally either DNA or RNA. The length of these is 15-30 nucleotides. The use…
Q: Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced…
A: Since you have posted multiple questions, we solve the first question for you. To get the remaining…
Q: ou are a bacteriologist studying a pathogenic protein (the “BAD” protein) that contributes to…
A: B -Asx A - alanine D =Asprtic acid a. K - b. D Lysine - Aspartic acid AAA, AAG - GAT, GAC
Q: From Lab 3: For each of the following examples assume you are starting with a linear piece of DNA.…
A: Restriction enzyme that cleaves DNA at specific site. Some examples of restriction enzyme are SmaI,…
Q: The structure of adenylate cyclase is similar to the structures of some types of DNA polymerases,…
A: adenylate cyclase DNA polymerases Convert ATP to cAMP Adds dNTP to DNA Plays role in signal…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: Indicate the biochemical activities for the enzymes listed below. Use the lettered list of…
A: There are various enzymes involved in DNA replication and transcription.
Q: Rifamycins have been used for the treatment of many diseases, including HIV-related Tuberculosis.…
A: Rifamycin is an antibiotic used to treat various pathological conditions which is synthesized…
Q: This shows where EcoR1 cuts, where HindIII cuts, and where BstEII cuts. Given that the entire…
A: Restriction enzymes are called molecular scissors and used in molecular biology and for gene cloning…
Q: the relationship between mutation of RECQ5 and human disease, in particular exploring the effects on…
A: RECQ5:- it is a type of helicases. It is an ATP dependent helicase that can binds with single…
Q: Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
A: Sickle cell anemia is the result of a point mutation in the hemoglobin gene. Sickle cell hemoglobin…
Q: Please describe the enzyme - mediated reactions required for a histidine, freely floating in the…
A: Histidine is a amino acid which is used in protein biosynthesis. The biosynthesis of histidine…
Q: Briefly explain the significance of telomerase in normal cells versus tumors and cancer cells
A: In promulgating progenitor cells deduced from labile normal stem cells as well as in embryonic stem…
Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…
A: Mutation is a sudden change on genome which leads to formation of change in mRNA and protein. There…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Q: Choose reactions that always require hydrolysis of ATP. Select all that apply. sliding along…
A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…
Q: Give examples of nonsense-mediated decay (NMD) as a friend/foe. With explanation please. thanks
A: Nonsense mediated decay is a type of correction made in the process of gene expression if it is not…
Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…
A: The mutation is a molecular process that alter the nucleotide sequence of the DNA. As the mRNA is…
A cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- . Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA formation.Which of the following would be a good chemotherapy approach: blocking formationof the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP?Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTPare related to these and how loss of the particular molecule would affect each process. *PEP carboxykinase in gluconeogenesis*Succinyl-CoA synthetase in the TCA Cycle*Glucagon signal transduction
- Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic perspective, why is this advantageous?Please do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…Indicate whether each of the following statements are true of depurination, deaminationor pyrimidine dimer formation and which repair process (base excision repair, nucleotideexcision repair) is pertinent to the statement; and explain why.A given statement may be true of one, or more than one, of these processes. Be sure toinclude some molecular detail in your explanation.A. Repair involves an endonuclease B. Repair involves DNA ligase C. Repair involves a helicase
- Match the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [ Choose ] Choose] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts % & 5 7True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
- PLEASE ANSWER ALL OF THEM. THEY ARE ALL CONNECTED MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA. 1.. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 2. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 3. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 4. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 5. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)Post-translational modification of proteins refers to the covalent and enzymatic modification of proteins following protein biosynthesis. Give three (3) examples and briefly describe why the modification is important.Indicate the biochemical activities for the enzymes listed below. Use the lettered list of activities to mark the activities of the enzymes involved in DNA replication and transcription. E. coli DNA polymerase I Human telomerase E. coli RNA polymerase holoenzyme yeast RNA polymerase || E. coli primase A. 5' to 3' RNA-dependent DNA polymerase B. 5' to 3' DNA-dependent DNA polymerase C. 3' to 5' RNA-dependent DNA polymerase D. 3' to 5' DNA-dependent DNA polymerase E. 5' to 3' DNA-dependent RNA polymerase F. 3' to 5' DNA-dependent RNA polymerase G. 5' to 3' exonuclease H. 3' to 5' exonuclease