CRISPR One of the more recent advances in biotechnology is the development of the CRISPR gene modification tool. Match the following descriptions the the key players in this technology. NOTE: If you want to change your selection, you'll need to delete the one you already chose. After you delete it, the list of choices will pop back up and you can make a different choice. CRISPR technology Specialized stretches of DNA with nucleotide repeats and Cas9 protein spacers Enzyme that cuts DNA crRNA Guides the enzyme to the target site CRISPR DNA Adapted from the natural defense mechanism of bacteria and archaea
Q: is possible to buy a CRISPR kit that you can do in your own home. Is this a good idea? After…
A: In 2013, the Zhang lab successfully published the first method to engineer CRISPR to edit the genome…
Q: Why must the gene be inserted into a vector for it to be cloned?
A: Vectors are carriers of target DNA which are readily used in recombinant DNA technology. The most…
Q: In this lab you learned about purifying DNA from a soil sample using a series of columns and…
A: INTRODUCTION DNA purification DNA purification helps in the extraction of genomic or plasmid DNA. It…
Q: Identify the correct sequence of steps involved in cutting and reassembling DNA molecules to make…
A: Answer: Recombinant DNA is the DNA which is made in the laboratory by combining two genetic…
Q: Which of the following types of mutations would be produced by repair of a CRISPR-targeted double…
A: Non Homologous End joining is described as the pathway required for the repairing of those double…
Q: Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium…
A: Deoxyribonucleic acid (DNA) is a particle made out of two polynucleotide chains that loop around one…
Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: A DNA library is a collection of clones, each containing a different fragment of DNA, inserted into…
A: According to the question, A DNA library is a collection of clones, each containing a different…
Q: Design as a set of primers, every 20 nucleotides in length. Using this sequence as a guide, design a…
A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…
Q: Match the activity below with the correct enzyme. (You won't use all the enzymes listed.) RNA acts…
A: DNA helicase is used during the DNA replication process where it binds to the double-stranded DNA…
Q: design a method to treat the most common mutation that causes sickle cell anemia using CRISPR/Cas.…
A: CRISPR Technology/ Clustered regularly interspersed short palindromic repeats is the technology…
Q: automated sequencing is used are given a printout of the sense strand of your DNA. The printout is…
A: Biomolecules are acknowledged as key components of electrical devices in DNA computing. This topic…
Q: Select the definition of a microsatellite. short pieces of DNA surrounding the periphery of the…
A: Answer
Q: What is a restriction endonuclease? Select one: a. It is an enzyme that cleaves at a specific…
A: Nucleic acids are large molecules that are made up of nucleotides that performs a various function…
Q: Which of the following is required to make complementary DNA (CDNA) from RNA? reverse transcriptase…
A: The central dogma in cell biology is DNA -> RNA -> Protein. The first process is the…
Q: Create a simple outline (yes, you can use bullets and outlines!) starting from plasmid DNA with your…
A: Bacterial transformation is a key step in molecular cloning, the goal of which is to produce…
Q: Which of the following statements about CRISPR are accurate? Select all that apply. O CRISPR…
A: The most accurate statements regarding CRISPR are - a, c and e.
Q: You are trying to study the effects of Drug A on the expression of Gene X in a tumor sample (lane…
A: Reverse transcription enzyme chain reaction (RT-PCR) may be a variation of normal PCR that involves…
Q: the most efficient general strategy for whole genome sequencing is ? (a) double the coding sequence…
A: Whole-genome sequencing abbreviated as WGS is a method used to comprehensively analyze the entire…
Q: Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded…
A: Amino acids are the organic compounds that contain amino group and carboxyl group functional groups…
Q: Which ingredient will allow the DNA to form cloudy clumps which can be collected with tweezers salt…
A: Introduction :- A given DNA segment can be quickly multiplied (amplified) into millions or billions…
Q: The figure below shows the recognition sequences and cleavage positions of three restriction…
A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…
Q: You’re working in a research lab, and your current task is to clone the gene that codes for…
A: The cloning process is used to introduced a foreign DNA into the genome of a particular host…
Q: You’re working in a research lab, and your current task is to clone the gene that codes for…
A: Recombinant DNA technology is one of most significant techniques of genetic engineering. It enables…
Q: Your colleague made the table below comparing DNA Polymerase to RNA Polymerases. Which row is…
A: Transcription is the molecular process which involves the DNA sequences that are transcribed as…
Q: The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA…
A: The following is the DNA information received by gel electrophoresis: In lanes 1 and 2, each…
Q: The Southern blot procedure was developed so that: DNA fragments that have been subjected to…
A: Southern blotting is the technique for the detection of specific DNA fragments. The detailed…
Q: CRISPR/Cas9 can be used in genome editing. Among the following statements, which one is correct?…
A: Bacteria have evolved various mechanism to resist against the viruses like bacteriophage some of…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…
A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Restriction enzymes... Choose the answer below: cut DNA molecules at random sites. are…
A: DNA or deoxyribonucleic acid is a double-stranded molecule, strands of which are coiled around one…
Q: You’ve made your construct and placed it into E. coli! Congratulations, you have made a transgenic…
A: Colony PCR is a rapid technique to determine whether the inserted DNA is present in the plasmid or…
Q: The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction…
A: The restriction enzymes cuts specific sequence on double stranded DNA molecule and they are used in…
Q: The complete genetic information of a person is isolated from some of her cells, cut with…
A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…
Q: You want to determine the transcriptomic response to heat shock in [Choose ] a normal cell line.…
A: Transcriptomic is the study of total RNA present at a particular time in a particular cell. To…
Q: Some restriction enzymes produce DNA fragments with overhanging stretches called sticky ends on each…
A: A restriction enzyme, is an enzyme that cleaves DNA into fragments at or near specific recognition…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: Introduction :- A nucleic acid sequence is a series of bases denoted by a set of five letters that…
Q: The Southern blot procedure was developed số that: DNA fragments that have been subjected to…
A: Answer 1) : Option " 1 " is correct : DNA fragments that has been subjected to electrophoresis…
Q: What causes microsatellites to be polymorphic?
A: Microsatellites are classified as variable number tandem repeats. These are 2-13 nucleotide long…
Q: molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: They are few methods which are used to to separate and identify the gene of interest. To isolate a…
Q: has been assembled by researchers and transplanted into a donor bacterial strain to study never…
A: A- recombinant plasmid B- developmental genetics
Q: 2. You want to clone a specific PCR amplicon. You have determined that the amplicon you want to…
A: pUC57 is a commonly used plasmid cloning vector in E. coli.
Q: Restriction endonuclease and ligase are two types of enzymes used in the process of genetic…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…
A: In molecular biology, sequencing is the most important phenomenon in which the the behaviour and…
Q: + DNA Fragment with Human Gene Recombinant Plasmid Plasmid Vector Bacterial DNA Recombinant Plasmid…
A: Since there are multiple questions in this particular question I will answer the first one for you.…
Q: Which of the following is true about restriction endonucleases?a) Type I and II requires ATP to move…
A: Restriction endonucleases are the specific DNA sequences that cleaves the sugar-phosphate backbone…
Q: Review DNA sequencing and cloning tools. Match term and its description. a cloning vector that…
A: A cloning vector that contain a highly active bacterial promoter is called the expression vector .…
Q: Can you think of any potential benefits of AFLP analysis over RFLP? Explain your reasoning.
A: AFLP is Amplifies fragment length polymorphism. It is a DNA typing method in which restriction…
Q: You have been hired as a genetic engineer. Your patient, Mr. Williams, is a 42-year-old male who has…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?A number of advances have been made in biotechnology. CRISPR/Cas9 one of the most controversial, and has had a lot of media attention in recent years. It is a method by which scientists can precisely edit DNA sequences at exact locations. Benefits obviously include the potential to “repair” mutated genes that cause disease. In fact, preliminary results from one of the earliest clinical trials of CRISPR/Cas9 provide evidence that the technique is safe and feasible to use for treating human diseases. What other potential applications of this application do you see (you can use any organisms to illustrate your answer)? What are the potential dangers or downsides of using this technology? Do you think this technology should be used in gene editing in humans? Explain your stance.
- CRISPR has the potential to change everything. What potential benefits of this technology are you most excited about? What possible drawbacks concerns you the most?Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACautomated sequencing is used are given a printout of the sense strand of your DNA. The printout is linked. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence The reading frame DNA sequence is: The mRNA sequence is: The polypeptide sequence is:
- Biotechnology There are several different tools used to study or manipulate DNA. Match the description to the technology. NOTE: If you want to change your selection, you'll need to delete the one you already chose. After you delete it, the list of choices will pop back up and you can make a different choice. Polymerase Chain Reaction (PCR) Replacing defective genes that caused a disease Gel Electrophoresis Circular DNA used to insert genes Molecular cloning Cuts DNA into smaller pieces Tool for gene editing Restriction enzyme Creates larger quantities of DNA Plasmids Produces genetically identical DNA fragments Separates fragments of DNA by size CRISPR Gene therapyWhat advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.In biotechnology, gene cloning is a very important technique. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is the plasmid. State the three (3) important regions of the plasmid. Elaborate your answer.
- What is complementary base pairing? Be able to figure out the nucleotide sequence of the 2nd strand of DNA if you’re given the first (as happens when DNA replicates); or the RNA sequence that would pair with a DNA sequence (as happens during transcription). What is Biotechnology? Recombinant DNA? What is a restriction enzyme and how is it used to make recombinant DNA? What is a transgenic animal? Transgenic crops? What is Forensics? Why are the following things important in forensic (or medical genetic) testing: PCR? STRs? What is CODIS? What is a multifactorial trait? A polygenic trait? Some examples of each? How do they differ from Mendelian traits? What is cancer? How do cancer cells differ from normal cells? Why is control of the cell cycle crucial? Genetic influences in developing cancer: what is an oncogene? a tumor suppressor? Difference between a benign and a malignant tumore? Metastasis?Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…What are "genetic biohackers" in reference to "do it yourself CRISPR kits"? Who is Josiah Zayner and what is he infamous for? Feel free to search that online...