Consider a bacterial promoter with -35 and -10 elements. What assay is best to show that RNA polymerase binds at regions centered on the -35 and -10 positions upstream of the start site of transcription? (Reviewing Chapter 7 in the textbook may help.) electrophoretic mobility shift assay chromatin immunoprecipitation assay DNA footprinting assay None of the above. O000

Consider a bacterial promoter with -35 and -10 elements. What assay is best to show that RNA polymerase binds at regions centered on the -35 and -10 positions upstream of the start site of transcription? (Reviewing Chapter 7 in the textbook may help.) electrophoretic mobility shift assay chromatin immunoprecipitation assay DNA footprinting assay None of the above. O000

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
What assay uses the fact that activators can be separated into DNA binding and activating domains? What information do you gain from this assay? Describe briefly how to perform this assay.
When Zidovudine (3'-azidothymidine or AZT) is added directly to an assay measuring the rate of DNA synthesis catalyzed by the AIDS virus reversed transcriptase, AZT is shown to be without significant inhibitory activity. Explain how AZT is metabolized in virus infected cells to convert the nucleoside into a potent and effective reversed transcriptase inhibitor.
Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name Recognition sequence and position of cut 5'GIAATTC3 5'G!GATCC3' 5'GIGTACC3 5'GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3 EcoRI ВатHI Аcс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >
Anti apoptosome anti N anti protein X anti caspase based on thé data above where is the WT protein actually cleaved D380 D380 and D835 D835 D835 and D840 D840 all are cleaved none are cleaved D380 and D840 if you compared the size of WT and the D380E mutant before apoptosis on a western blot how would they appear? D380E would be larger they would be indistinguishable WT would be larger how many amino acids long is the larger band in the lane labeled D380E/D835E
Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose you pretreat cells with or withoutepinephrine and then prepare a cell extract that contains theCREB protein.You then use an electrophoretic mobility shift assay to analyzethe ability of the CREB protein to bind to a DNA fragmentcontaining a cAMP response element (CRE). Describe what theexpected results would be.
Describe what each of the 12 bands on your Western blot should have been. Remember, the 12 bands will be 4 conditions x 3 proteins (phospho-S6, phospho-AMPK, tubulin). Please describe the relative density of each band compared to the control (for example, how dense will phospho-S6 be in each of the three experimental conditions compared to the control condition?). For each band, provide a well-reasoned rationale for your anticipated result. Give the reason why cell signaling would produce each result in each condition.
Cre-Lox system is used for site-specific modification of DNA for genetic engineering applications. The reporter gene construct shown below is used to test the Cre-Lox system. Cells are transfected with the construct shown below and the activity of the constructs is determined by visualizing the cells with a fluorescence microscope. Match the following conditions with the expected cell observations. Hint: Make sure you note the position of the Start and Stop. The GFP and RFP genes shown do not have start codons. Cre/Lox Reporter Gene ATG LoxP CMV-Pro A. No Expression GFP Stop B. GFP Only LoxP Absence of Cre Cells treated with drug that induces expression of Cre RFP C. RFP Only A. Image A B. Image B C. Image C D Image D express ? D. RFP and GFP
Explain the process of how X-gal screening works with pUC19, you may build a model with boxes and arrows. 2. You are utilizing BamHI (GGATCC) restriction site and HindIII (AAGCTT) restriction site. Within pUC19, BamHI is at position 263, while HindIII is at position 233. (Hint: position is like coordinate on a map). If you manage to insert GTF2H5 in pUC19 vector, what are the sizes of fragments if you digest the pUC19-GTF2H5 (this is after insertion) with the following restriction enzyme combination after gel electrophoresis: BamHI and HindIII There is an NdeI site right in the middle of the GTF2H5 that has been inserted in pUC19, what would be the fragment sizes, if you digest with BamHI and NdeI. HindIII and NdeI BamHI, HindIII, and NdeI. 3. Design an experiment to confirm the presence of insert GTF2H5 in pUC19 vector using the following method (besides restriction analysis above), assuming that you know the sequence of GTF2H5: Southern Blot Polymerase Chain Reaction
Following method is used to study long-range chromosome interactions Digestion by restriction endonuclease Northern Blot Chromatin Immunoprecipitation Chromosome conformation capture assays