Choose a disease of the digestive system and discuss the following: - Indicate why you chose the disease - Causative agent - signs/symptoms - Treatment - Anything significant about the disease
Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…
A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…
Q: Large caliber arteries during systole stretch and return to the baseline during diastole, ensuring…
A: Due to pulsatile flow of blood, the mechanical stretch in the blood vessel called arteries is mostly…
Q: Based on your understanding on the basic structure of fungi especially on the fungal cell membrane.…
A: Fungi Fungi are the uni to multicellular organisms and are non photosynthetic in nature.
Q: Marie diluted her phage lysate from 10° to 109. She completed the titer assay protocol using these…
A: This question is about dilution.
Q: Which of the following are recommendations for dietary fat intake in athletes? Check all that apply.…
A: Option 1 is correct . Athletes should consume 20 to 35 percent of their calories from fat. Option 2…
Q: , differentiate the effect of two varying pH levels (as indicated by by the color) to the amylase…
A: It is an enzyme which is produced by salivary glands and it have seen hydrolysis and digestion of…
Q: 2. Calculate the following: a. you are asked to prepare 10 NA slants and 5 NA stab in big tubes. How…
A: Growth media also known as culture media are used to cultivate microorganisms. These media are a…
Q: The fact that muscles and skeletons work together to move the body from place to place is an example…
A: Living organisms exhibit life processes that are absent in nonliving objects.
Q: Compare monocot, herbaceous dicot and woody dicot stems. Indicate presence or absence of the…
A: Introduction Monocot stem refers to the stem of the monocot plants, it is a circular-shaped hollow…
Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…
A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…
Q: Angiotensin is a hormone that stimulates vasoconstriction and increases blood pressure. Which effect…
A: Answer :- Option (D) is correct. - decreased reabsorption of sodium in the kidneys.
Q: What is diabetes mellitus? Differentiate between Type I and type II diabetes
A: Introduction :- A condition in which the body's glucose (a type of sugar) levels are out of control…
Q: Colony of (bacteria): A cluster of cells (or clones) which arise from a single bacterium by asexual…
A:
Q: what two reactants are combined to form a molecule of ATP?
A: what two reactants are combined to form a molecule of ATP? Introduction: The essential molecule for…
Q: SARS-CoV-2 spike engagement of ACE2 primes S2' site cleavage and fusion initiation
A: The SARS-CoV-2 virus's spike (S) glycoprotein is a class I fusion protein which covers the viral…
Q: What is the significance of Juxtaglomerular apparatus in kidney function.
A: Introduction - The kidneys are two bean-shaped organs located on either side of your spine, below…
Q: QUESTION 25 What is the value of identifying prevalent base changes found in different cancer types?…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: Jim hasn't been having success in growing strawberry plants for the past few years, so he got his…
A: The observation of the following experiment conducted by Jim is there is some problem with the soil…
Q: of most hemoglobins when: 1. deoxygenated blood enters the capillaries in the lungs. 2. oxygenated…
A: Answer :: Hemoglobin-oxygen dissociation curve as the name suggests describes the relation…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: Which of the following regarding aldosterone is false? the process leading to its release begin with…
A: The option 1 is correct as renin begins the cleavage of angiotensinogen to form angiotensin II. This…
Q: is a normal cellular gene that through a A an oncogene. OA) proto-oncogene...loss-of-function OB)…
A: An oncogene is a cancer-causing gene that has been mutated. A proto-oncogene is a type of oncogene…
Q: ELISA requires the use of blocking solution; what is the purpose of the solution?
A: The enzyme-linked immunosorbent assay captures target antigens (or antibodies) in samples using a…
Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…
A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…
Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?
A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .
Q: From the early 1700s to the modern day, how did various lines of evidence refine scientists'…
A: Cetacean is classified as a group that comprises whales, and dolphins along with the porpoises.…
Q: Regeneration of RUBP happens here." O Light Reaction O Calvin Cycle Both Light Reaction and Calvin…
A: Calvin cycle is the correct answer. RuBP the molecule that starts the cycle is regenerated so that…
Q: Describe the three domains of a receptor tyrosine kinase. Explain the structure of the…
A: Receptor Tyrosine kinase are the most effective high affinity cell surface receptors that acts for a…
Q: True or False The physical life is always greater than all the other “life” factors under…
A: Answer: false because the physical life is not always greater than aal the other life factors under…
Q: Characterize the scope of indoor air pollution and assesssolutions
A: Air pollution is the addition of substances to the air that lowers its quality.
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: Synapse, also known as neuronal junction is the site of transmission of electric nerve impulses…
Q: Name and describe the main fuctional macromolecule found in red blood cells
A: Blood is made up of liquid and solids. The liquid part, called plasma, is made of water, salts, and…
Q: You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing…
A: Answer :- Option (B) is correct. - The cell depolarizes, with brighter light causing more…
Q: Describe the process of DNA replication of the leading strand?
A: DNA replication It is the process by which DNA make exact copy of itself. The replication of DNA is…
Q: List three characteristics that distinguish Homo sapiens from premodern Homo Homo sapiens have a…
A: Scientific data gathered on human evolution suggests that the physical as well as behavioral…
Q: Why is oxygen needed for cellular respiration to occur (what is its role at the mitochondrial…
A: Cellular respiration is the metabolic process that takes place in the mitochondria of cells. It…
Q: 13 15 DSS karyotic organisms that cause infections eases that can't be caught (passed from person to…
A: Disease is a state of illness which could be contagious that is spread from person to person or…
Q: Besides the Warrior gene, the only other genetic mutation directly correlated with “super-maleness”…
A: As mentioned in many scientific literature the warrior gene which is normally referred to as MAOA…
Q: Match the evidence of evolution with its description: f Comparative Anatomy a. structures that don't…
A: Comparative anatomy - comparin strucrures to show species has shared ancestry. Homologous organ -…
Q: Describe the process of Translation of mRNA to DNA.
A: Ribonucleic acid (RNA) can be described as a chemical present in a wide range of living creatures,…
Q: Specialist species can eat a variety of foods and have broad niches O be vulnerable to extinction…
A: Specialist Species can be vulnerable to extinction when environment changes because they have narrow…
Q: QUESTION 15 Which of the following does not change gene frequencies in populations? selection O…
A: Introduction :- The relative frequency of an allele (gene variant) at a specific locus in a…
Q: Which of the following is NOT a typical mechanism by which a proto-oncogene is converted to an…
A: Proto-oncogenes are healthy genes that are found in the cell. They play a very important role in…
Q: explain why biodiversity is the life insurance of itself?
A: Biodiversity- Biodiversity is the biological variety and variability of life on Earth.
Q: why a mutant Ras is an oncogene causing many human cancers
A: Ras proteins are proto-oncogenes that are frequently mutated in human cancers.
Q: How does temperature and PH affect the activity of enzymes.
A: Introduction Enzymes function as catalysts. Proteins are the most common, although some RNA…
Q: F E D H 1-09 G H life cycle life cycle A C B
A: Virus is a minute entity just like other microbe but have small size. It has dua nature . It behave…
Q: Septic shock is life - threatening condition caused by an overwhelming
A: Septic shock- it is a condition sometimes occurs in severe sepsis, in which the blood pressure…
Q: 1. What is a microtome? Write four types of microtomes and their uses. 2. What are the steps to…
A: We are allowed to do upto three subpart of a question. Please repost the undone question again.…
Q: Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the…
A: Primase is an RNA polymerase that requires ssDNA to make RNA primers during DNA replication.
Choose a disease of the
- Indicate why you chose the disease
- Causative agent
- signs/symptoms
- Treatment
- Anything significant about the disease
You don't have to elaborate. Try to introduce the disease to your colleagues in the discussion board in a simple language so we all understand
.
DO NOT USE GERD
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Choose a disease of the digestive system and discuss the following:- Indicate why you chose the disease- Causative agent- signs/symptoms- Treatment - Anything significant about the disease You don't have to elaborate. Try to introduce the disease to your colleagues in the discussion board in a simple language so we all understand.Use any news article doesn't matter just has to be on disorders of the digestive system . The article you select should include information about topics such as research on the chosen topic, new treatments, new technology, and/or diagnostic tools. It should be a current article (i.e., published within the last two years). Try to make it about 300 words whatever you can do. just tell me the website or article that was used !Differentiate between bacterial infectionand bacterial intoxication. Discuss the importance of E. colias part of our intestinal flora. Describe three (3) different types of gastrointestinal diseases caused by bacteria. Be sure to give the name of the specific organism that causes each, describe some common signs and symptoms and discuss treatment for each disease: Define meningitis.Compare and contrast between bacterial and viral meningitis including treatment for each. What is a prion? Describe the impact prionshave on the human brain and discuss two prion-associated diseases in humans: What is a vector-borne (vector transmitted) disease? Give an example of a vector borne disease and the vector responsible for causing it:
- Give typed full explanation Consider an infection of the gastrointestinal or genitourinary system that you've seen. Tell us about the patient, some signs and symptoms, general information about how the patient felt, acted, etc. What disease did they have, how did they contract it, and what did you notice most about it? (We can choose any infection of the gastrointestinal or genitourinary system.)Explain in details what is the gastrointestinal tract infection that cauesd by viruses? Attach any pictures or drawing or vedioes related to this subject, please.Please write a one page description of a digestive or metabolic disease
- The chronic degenerative disease of the liver characterized by scarring is known as serosis. ________________________________Divide each term into its component word parts. Write these word parts, in sequence, on the lines provided. When necessary use a slash / to indicate the combining vowel. You may not need all of the lines provided. Cytomegalovirus is a member of the herpesvirus family that causes a variety of diseases. ______________________________________________________A/An _____________________________ diagnosis is also known as a rule out.
- The surgical removal of all or part of the sigmoid colon is a/an ___________________.jeccd.instructure.com/courses/28204/quizzes/155149/take Problems with the Digestive System: Match the description on the left side to the correct disease/disorder in the dropdown menu on the right. Inflammation and infection of [ Choose] outpouches in the lining of the colon [ Choose ] Crohn's Disease A genetic auto-immune disease that causes people to have an Celiac Disease immune reaction to the protein gluten, damaging the villi of the Diarrhea small intestine. Constipation A severe and chronic splashing of Peptic Ulcer stomach acid and enzymes in the GERD esophagus, throat, mouth, or airway that causes inflammation and injury to those organs. Irritable Bowel Syndrome Diverticulitis Frequent, watery bowel movements usually caused by diet, Ulcerative Colitis stress, infection, etc. >In the article "Epidemiology of Gastric cancer in Japan": 1. What are the new ideas/ information you learned from the research article? 2. Do you think the experiences of Japanese individuals in relation to gastric cancer are applicable to Filipinos? Why? 3. In what ways do Japanese and Filipinos differ in food preferences and eating habits? What are their similarities?
![Medical Terminology for Health Professions, Spira…](https://www.bartleby.com/isbn_cover_images/9781305634350/9781305634350_smallCoverImage.gif)
![Medical Terminology for Health Professions, Spira…](https://www.bartleby.com/isbn_cover_images/9781305634350/9781305634350_smallCoverImage.gif)