Brown induration of the lungs H&E staining, Perls reaction Mark the corresponding elements in the picture: A - H&E staining B – Perls reaction 1 – intraalveolar hemosiderin 2 - interstitial hemosiderin 3- alveolar lumen 4 - thickened, sclerosed alveolar walls Description: Perls's reaction is
Q: Discuss biofilms and their relevance to infectious diseases
A: According to the guidelines of Bartleby,Since you have posted multiple questions, the expert can…
Q: Classify each action as belonging to genetics, genomics, or both.
A: The structural-functional unit of a hereditary is known as gene.. and the study of heredity is known…
Q: You are dissecting a young fetal pig whose testes have not descended yet. To find the testes in this…
A: Unborn pigs called fetal pigs are utilized in both basic and higher biology schools as dissection…
Q: Select all CORRECT answer choices regarding the following question: "Which of the following are…
A: Bacteria are prokaryotic, single-celled, heterotrophic organisms. As they are heterotrophic…
Q: All valves are closed, ventricular pressure decreases. Blood flows passively through the atria and…
A: All valves are closed, ventricular pressure decreasesBlood flows passively through the atria and AV…
Q: A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pl, bk,…
A: The scenario presented involves an exploration of genetics using Drosophila or fruit flies. In this…
Q: How does inhibition of the Na+/K+ ATPase increase the force of heart muscle contraction? O It…
A: Sodium (Na+) and chloride (Cl-) ions are essential for maintaining fluid balance, nerve function,…
Q: Identify the following (explain in 1-3 sentences): Description: Embryonic origin : Function :…
A: All the tissues mentioned above are connective tissues and their primary function is to bind other…
Q: These structures allow a bacterium to move through an aqueous environment: spores cilia flagella…
A: Microbes have evolved a wide range of specialised structures, such as spores, capsules, fimbriae,…
Q: Certain cells in your pancreas make digestive enzymes that are secreted into ducts and carried to…
A: The pancreas is an abdominal organ located behind the stomach, surrounded by the spleen, liver, and…
Q: For the lipids within the bilayer that comprise the plasma membrane: The hydrophilic ends face…
A: Structure of cell membraneLipid Bilayer-2 layers of phospholipidsPhosphate head is polar (water…
Q: The most important reward circuit in the brain is the mesolimbic pathway. Dopaminergic neurons…
A: The mesolimbic pathway is a critical neural circuit in the brain associated with the experience of…
Q: 6 = W - 1 A 2 C ♦ ( ◆ ♦ N/A (> ◆ ◆
A: In a complementation chart a group will contain similar mutations that failed to compliment one…
Q: Suppose a mutant RNA polymerase Il is used that lacks one of the phosphorylation sites on the…
A: The production of RNA from the DNA template is known as transcription or gene expression. The main…
Q: Which of the following statements is false concerning the motor protein families of kinesins and…
A: Kinesins and dyneins are molecular motor proteins responsible for intracellular transport in cells.…
Q: Termites are a diploid eusocial species in which a colony's queen and king produce both sons and…
A: The change in the characteristics of a species over a period of time and over a several generations…
Q: Which of the following primers could extend this piece of single stranded DNA in a PCR reaction?…
A: In molecular biology and genetic research, the Polymerase Chain Reaction (PCR) is a fundamental…
Q: Sanger spectrophotometer Coulter counter plate counts centrifugation direct Petroff-Hauser turbidity…
A: Microbiology is the study of the biology of microscopic organisms - viruses, bacteria, algae, fungi,…
Q: Which one of the following is not true about PEA medium? Select one: a. Contains sodium…
A: PEA medium is a specialized agar used in microbiology to isolate and grow Gram-positive bacteria…
Q: When subculturing some fibroblast primary cell culture; you encountered a problem that the cells…
A: During the process of cell adhesion, cells interact and link with one another via specialized…
Q: f you breed fast box turtles and use midparent-midoffspring regression to determine that the…
A: In the world of breeding and genetics, the idea of heritability performs a critical position in…
Q: Ye are helping clinicians to diagnose a patient with a rare liver condition. After some preliminary…
A: PHGDH is an enzyme that stands for Phosphoglycerate Dehydrogenase. This enzyme plays an important…
Q: Phalaropes are shore birds with brightly colored females and dull colored males. Females are larger…
A: Sexual dimorphism is described and defined as the differences in size, looks, appearance, or…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…
Q: The peptidoglycan layer in a Gram-negative cell is typically .008 um thick while the peptidoglycan…
A: In microbiology, bacterial cell walls play a crucial role in determining the characteristics and…
Q: Zygote Cleavage (Blastula) Cleavage (8-cell stage) Early Gastrula
A: The development of an organism begins after the fertilization process. Fertilization involves fusion…
Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…
A: The correct answer is option D. Sex-linked recessive.
Q: Identify the key structural features of a DNA molecule.
A: DNA i.e. Deoxyribonucleic acid is the molecule that carries genetic information for the development…
Q: Which of the following include the correct order of phases of a typical bacterial growth curve? log,…
A: Microorganisms grown-up in closed culture also called as a batch culture in that no nutrients are…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Since you have posted multiple questions, we will provide the solution only for the first question…
Q: make a concept map out from the essay below. The epic story of a single sperm facing incredible…
A: Fertilization is a multi-step, complex process that takes 24 hours to complete. The beginning of…
Q: Describe and draw the spinocerebellar pathway, dorsal column-medial lemniscal pathway, spinothalamic…
A: Temperature, light touch, pressure, tickle, and itch sensations are transmitted by the…
Q: You are required to select your organisms from four different phyla. You cannot use the same phylum…
A: Phylum Mollusca:Organism: Giant Clam (Tridacna gigas)Taxonomic Structure: Kingdom: Animalia, Phylum:…
Q: One example of non-Mendelian inheritance is uniparental inheritance. Choose the definition of…
A: Non-Mendelian genetics refers to inheritance patterns that do not follow the simple Mendelian…
Q: 2. Certain varieties of chrysanthemums contain 18, 36, 54, 72 and 90 chromosomes. How would you…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: 3. During the course of successful prenatal development, a human organism begins as a(n): A) Zygote…
A: The goal of developmental biology is to comprehend how an organism develops—how a single cell…
Q: Which of these statements accurately describes the myeloid-derived suppressor cells (MDSC) involved…
A: The uncontrolled division of cells leading to the formation of a cell mass called a "tumor" is known…
Q: What are functions of the M7G cap? Select all the apply. Slows degradation from the 5' end of the…
A: The process by which mRNA is produced from DNA is called transcription and the process by which…
Q: If interference is complete (i.e., 100% effective), what is the frequency of double crossovers one…
A: Interference is defined as Inhibition of further cross over events by a crossover event in a nearby…
Q: In adoptive immunotherapy for melanoma, tumor-infiltrated lymphocytes(TILs) are expanded ex-vivo…
A: Melanoma is a serious and usually fatal kind of skin cancer that develops from melanocytes, the…
Q: Sugar residues that are attached to proteins embedded within the plasma membrane, that play a role…
A: The question pertains to a fundamental aspect of cell biology and the structure of the plasma…
Q: Which two of the components of DNA from the backbone of the molecules?
A: DNA, or Deoxyribonucleic Acid, is a molecule found in the cells of living organisms, including…
Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…
A: Mutation is the change in DNA sequence or the number of chromosomes in an organism. In some cases…
Q: The reaction below shows the energy changes in a chemical reaction. Reaction pathway What would…
A: Enzymes are biocatalysts that are responsible for speeding up a chemical reaction within (and also…
Q: See image
A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: Consider a gram negative pathogen isolated from marine mammals. This pathogen is subjected to a…
A: Here in this question we are given certain characteristics and on the basis of it we have to…
Q: 1. For each question, use allele symbols and text to explain your answer. A. Is it possible for a…
A: The blood group depends on the presence of specific antigens on the membrane of RBCs and red blood…
Q: In many types of tumors, the genomic DNA methylation pattern is changed either through…
A: Out of the options listed in the question, most promising potential cancer therapy that can restore…
Q: This is an image of skeletal muscle tissue. Identify the structure labeled "A" (a) (b) myosin…
A: Muscles are exceedingly specialized soft tissues that play a pivotal part in creating movement and…
Q: What effect does a high carbon level have on the deep ocean? Why might it be important to keep an…
A: A high carbon level in the deep ocean can have several effects:Ocean Acidification: Elevated carbon…
![Brown induration of the lungs
H&E staining, Perls reaction
Mark the corresponding elements in the picture:
A - H&E staining
B - Perls reaction
1 - intraalveolar hemosiderin
2 - interstitial hemosiderin
3- alveolar lumen
4 - thickened, sclerosed alveolar walls
Description:
Perls's reaction is](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fe8c7f155-63fb-400c-a1a8-a0e7bac9ee3c%2Fd89faa5a-f0c8-47bc-a08f-11e18ae04a5c%2Fbvmisdc_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 4 steps with 1 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Which are not allosteric effects that occur in hemoglobin? Are used by H* Involve binding away from the heme group Increase the Hill coefficient nH Reduce the affinity of heme for O2 Are used by DPGTo demonstrate an understanding of oxyhemoglobin binding, insert a word from the list in each blank to complete the statements. Not all terms will be used. increased A right shift of the oxy-hemoglobin curve signifies a affinity for oxygen. hold acidic A temperature will cause a right shift of the oxy- hemoglobin curve. basic A more pH than normal blood pH will cause a right shift higher of the oxy-hemoglobin curve. As a person exercises, their muscles give off heat which raises the temperature of the blood. This will cause hemoglobin to more oxygen at the cells. lower release decreaseda.What is the difference between the 5th and 6 coordination sites in the heme group? b.What is the change of the oxygen dissociation curve represented by hemoglobin before and after dissociation into subunits? Briefly explain why.
- P50 in Oxy-Hemoglobin dissociation curve represents That partial pressure(PaO2) of dissolved form at which Hb is 50% saturated with Oxygen50 mmHg difference between PAO2(alveolar) and PaO2(systemic)50% oxygen in dissolved form that ambient pressure at which PAO2(alveolar) is 50mmHgPaO2 of 50mmHgInternal respiration During internal respiration, the small amount of oxygen transported in dissolved plasma (1) quickly diffuses out of the plasma into interstitial fluid. Carbon dioxide diffuses into the blood and a small amount remains dissolved in the plasma (2). Most of the carbon dioxide continues into the red blood cell where some of it combines with hemoglobin (3) to form carbaminohemoglobin (4). Most carbon dioxide, however, combines with water (5) to form carbonic acid (6). This reaction is catalyzed by carbonic anhydrase. The carbonic acid then dissociates into hydrogen and bicarbonate ions (7). As bicarbonate ion concentration inside the red blood cell increases, bicarbonate ions diffuse out of the red blood cell into plasma (8) in exchange for chloride ions (9). Bicarbonate ions act as buffers within the plasma, controlling pH. Within the red blood cell, hydrogen ions (10) are buffered by hemoglobin (11). When hemoglobin binds hydrogen ions, it has a lower affinity for…Compare the three spectra. What can you observe when the starting hemoglobin is diluted? Does the position (λ) of the maximal absorption peaks change? Describe your observations.
- d) Determine which statements apply to hemoglobin, myoglobin, or neither (you can write in the corresponding numbers for each statement, as appropriate) Hemoglobin Myoglobin Neither 1. Oxygen binds irreversibly to this molecule.2. This molecule has greater affinity for oxygen.3. The oxygen dissociation curve is sigmoidal in shape.4. Carbon monoxide binds at an allosteric site, lowering oxygen binding affinity.5. The binding pattern for this molecule is considered cooperative.6. This molecule delivers oxygen more efficiently to tissues.7. As oxygen binds to this molecule, the shape of the molecule changes, enhancing further oxygen binding.8. The oxygen dissociation curve is hyperbolic in shape.Below is the oxygen saturation curve for myoglobin and hemoglobin at a pH of 7. The p50 for myoglobin is indicated by the dashed lines on the graph. Mb and Hb O2 saturation: pH 7 10 0.8 Myoglobin 0.6 P50 = 0.2 0.4 Hemoglobin 0.2 - 0.0 pO2 [kPa] Which of these molecules (Mb/Hb/neither or both) has cooperativity? [ Select ] What would you expect to happen to the p50 of myoglobin if the pH were decreased to a pH of 4? [ Select ] Fraction saturationExplain how the binding of molecular oxygen (O2) to haemoglobin affects the tertiary structures of each monomer. Hence, explain how this influences the quaternary structure of the haemoglobin molecule, and how this helps haemoglobin to transport O2 from the lungs to the muscles.
- Respiratory Concept Mapping Construct a map of gas transport using the following terms. You alveoli arterial blood carbaminohemoglobin carbonic anhydrase chloride shift dissolved CO₂ dissolved O₂ hemoglobin hemoglobin saturation oxyhemoglobin Po CO2 plasma 02 pressure gradient red blood cell venous bloodDipal mitoylphosphatidylcholine is the major component of surfactant, or surface active agent (an amphipathic molecule), that is secreted into lung alveoli to reduce the surface tension of the primarily aqueous extracellular fluid of the alveolar epithelia. Alveoli, also referred to as alveolar sacs, are the functional units of respiration. Oxygen and carbon dioxide diffuse across the walls of alveolar sacs, which are one cell thick. The water on alveolar surfaces has a high surface tension because of the attractive forces between the molecules. If the water’s surface tension is not reduced, the alveolar sac tends to collapse, making breathing extremely difficult. If premature infants lack sufficient surfactant, they are likely to die of suffocation. This condition is called respiratory distress syndrome. Draw the structure of dipalmitoylphosphatidylcholine. Considering the general structural features of phospholipids, propose a reason why surfactant is effective in reducing surface…Below is the O₂ binding curve for adult Hb in whole blood (containing BPG) shown in red (labelled Hb). Fraction of Hb bound with Oxygen 1.0 0.8 0.6 0.4 0.2 0.0 0 20 40 pO2 (torr) 60 80 ABC c. Which curve lacks cooperativity? [Select] Hb 100 a. Which curve is the best representation for stripped Hb (pure hemoglobin with heme, but no other small allosteric molecules associated)? [Select] b. Which curve has the lowest affinity (as measured by the p50)? [Select]
![Human Physiology: From Cells to Systems (MindTap …](https://www.bartleby.com/isbn_cover_images/9781285866932/9781285866932_smallCoverImage.gif)
![Human Physiology: From Cells to Systems (MindTap …](https://www.bartleby.com/isbn_cover_images/9781285866932/9781285866932_smallCoverImage.gif)