Answered: Black coffee has pH levels as low as 5.…

Black coffee has pH levels as low as 5. Lemon juice has a pH of 2. This means that the lemon juice is times more acidic than the black coffee.

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter2: Chemistry Of Life

Section: Chapter Questions

Problem 1CT: The pH of black coffee is 5, and that of milk of magnesia is 10. Is the coffee twice as acidic as...

See similar textbooks

Related questions

Q: Which type(s) of reservoirs are the hardest to control & make some diseases impossible to eradicate?…

A: B. Humans and c. Environment

Q: Describe the interactions of Agrobacterium tumefaciens with its host plant. Why is this plant…

A: Introduction: The bacterial pathogen Agrobacterium tumefaciens is a vital component in plant genetic…

Q: In the classic 1994 paper, "Does More Intensive Treatment of Acute Myocardial Infarction in the…

A: The passage is talking about the elderly patients who suffer from acute Myocardial Infarction which…

Q: 1. A person kept a diet without proteins for a long time, severally limiting proteins in food. In…

A: Introduction Various biomacromolecules like proteins, carbohydrates, along with vitamins and…

Q: Which of the following are reproductive organs? Select all that apply A. Root B. Leaf C. Stem…

A: In plants, which organs are directly responsible for sexual reproduction, or take part in sexual…

Q: In this diagram, which of the following is TRUE? H+ (proton) Organic molecule that includes two…

A: Option B ) The NAD+ becomes reduced.

Q: one potential treatment for addiction is to inhibit the expression of the gene that codes for the…

A: Addiction is a complex condition that is characterized by compulsive drug-seeking behavior and drug…

Q: Explain the difference(s) that exist between Monocots & Dicots in the Table below: Monocots Dicots

A: Monocotyledons, also known as monocots, are flowering plants (angiosperms) that resemble grass and…

Q: 22. The energy source used in translocation a) ATP b) UTP c) CTP d) GTP

A: A. ATP

Q: peptide bond Primary Structure Secondary Structure Tertiary Structure NH3+ Quatern Structur 2. Using…

A: Amino acids sequences linked together by peptide bonds form the primary structure of a protein. Any…

Q: define biomonitoring.

A: Biomonitoring is a process of monitoring the health and/or environmental quality of an environment…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: 6. Define which of the following results (pH, HCO³ mmol/l, Pcomm Hg) take place in a patient who…

A: Smoking is a leading cause of preventable deaths worldwide and is linked to a variety of health…

Q: Activation of the beta-gamma subunit associated with the Go protein complex would lead to what…

A: Ans) Closing of presynaptic Ca++ channels Option 1 is correct because the activation of the Go…

Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…

A: A diagrammatic representation of biological entities related via common descent, like species or…

Q: statement(s) describe the function of the protein encoded by KMT2D ? Transcription factor…

A: statements describe the function of the protein encoded by KMT2D are---- ## The protein encoded by…

Q: Name the connection between the hypothalamus and the posterior pituitary gland. What does it consist…

A: Pituitary gland is an endocrine gland that mainly consists of two lobes called anterior and…

Q: Describe the differences in gene expression that can occur in cells that are attached to a biofilm…

A: The behavior and survival of microorganisms are greatly affected by their environment. One of the…

Q: 1 67 почуття

Q: O Lipid Functional protein Nucleotide Polysaccharide Monosaccharide Polymer Tertiary (protein)…

A: Five images labeled A, B, C, D and E are given and we have to assign these images to the given list…

Q: 3 The experiment of Miller and Urey demonstrated that: That multicellular organisms form easily in…

A: Introduction The Miller-Urey experiment stimulated conditions thought at the time to present on…

Q: 10. Many traits seen in organisms are wildly inefficient and prone to malfunction or injury. Why…

A: Genetics can help us understand the evolution of species: By studying the genetics of different…

Q: Without oxygen, life cannot exist. Select one: True False

A: Introduction : Respiration is the process through which the nutrients we eat are converted into…

Q: What happens when large natural and/or man-made deforestation occur? How does the plant control the…

A: The epidermis of plant cells has specialized openings called stomata. They are crucial to the carbon…

Q: Label this drawing of a plant cell

A: Plant cells are defined as the eukaryotic cells which differ from those of other eukaryotic species…

Q: What types of global regulatory mechanisms might a cell use to control the changes in gene…

A: Attachment is a crucial process for cells, as it allows them to interact with their environment and…

Q: Trace the development of a megaspore mother cell to the formation of mature embryo sac in a…

A: The development of the megaspore mother cell (MMC) is the formation of the mature embryo sac &…

Q: Glands 1. Adrenal gland 2. Pituitary gland 3. Pancreas 4. Thyroid 5. Reproductive glands Disorder…

A: There are vital organs called glands all across the body. They create and expel chemicals which…

Q: What are the big differences between eukaryotic (nuclear) and prokaryotic genomes? How do…

A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…

Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…

A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…

Q: Explain how meiosis and fertilisation produce variation within a population.

A: There are several factors that contribute to genetic variation in populations. Natural genetic…

Q: The waved albatross feeds exclusively on marine organisms and has no access to fresh water. It has…

A: Albatrosses have salt glands just behind their eye sockets. This salt gland allows them to get rid…

Q: Biological Macromolecules, Fill in the blank: Elements Present C,H,O Macromolecule Carbohydrates…

A: Molecules such as carbohydrates, fats, proteins and nucleic acids are all different types of…

Q: Write a ½ page story using the following animal science terms in their proper context. Farrow, stag,…

A: This is a story formed using the above mentioned animal science terms in their proper context.

Q: Components of blood plasma, intercellular fluid and lymph. Proteins of plasma and their role in an…

A: Circulatory system is a type of body system which is involved in circulation of body fluids . It is…

Q: The complete aerobic respiration of glucose yields far more energy stored in ATP than glycolysis…

A: Respiration is the process in which organic compounds are oxidized to release free energy inside the…

Q: A child weighing 28 pounds is to receive acetaminophen for fever and pain. The recommendations for…

A: Given that weight of the child is 28 pounds. Therefore, weight in kg's = 28 × 0.454 = 12.7 (Because…

Q: Describe the main difference between the planarian and vertebrate digestive systems. Question 13…

A: Introduction:- Digestion involves the conversion of macromolecules like carbohydrates, lipids and…

Q: Describe the processes of meiosis and mitosis

A: "Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: 4. 0,5 liters of isotonic glucose solution was infused into experimental animal. As a result of it…

A: Erythrocites/ red blood cells: The most prevalent form of blood cell and the main source of oxygen…

Q: Chymotrypsin

A: N-terminal amino acid residue: It is the end with a free amino group. C-terminal amino acid…

Q: Which of these best describes the action of the Calvin Cycle? a. b. C. d. It uses CO₂ from the…

A: A series of chemical reactions known as the Calvin cycle turns carbon dioxide and hydrogen-carrier…

Q: In some cats, the length of the tail shows incomplete dominance. The tail can be long (L), short…

A: Incomplete dominance also called as partial or incomplete dominance, a phenomenon in which two true…

Q: Describe the role of the endocrine pancreas Describe the location and function of the pineal gland,…

A: The endocrine system is a complex network of glands and organs that secrete hormones into the…

Q: Which of the following is an important model organism for studying development? a. E.coli O b. D.…

A: Model organisms: When the process of development is studied in detail the model organisms…

Q: Describe an experiment to test whether soil pH affects the growth rate of sunflowers. Include all of…

A: Research can reveal gaps in our knowledge and understanding of plant development, guiding future…

Q: Consider the cladogram shown. 1. Which pair of species shares the greatest number of derived…

A: Systematics tells about the relationship between taxons. Phylogenetic tree is given in the question.…

Q: Predictions are statements about the evidence you might expect if a hypothesis was supported.…

A: In order to determine how a specific phenomenon occurs, what is the process behind an event,…

Q: What is the most common portal of entry? Question 12 options: a) food & water b) mucous…

A: E. Respiratory aerosols

Q: describe the structure and function of spinal cord as part of central nervous system .

A: The central nervous system is made up of the brain and spinal cord (CNS). In humans, the spinal…

Question

Give Detailed Solution (don't give Handwritten answer.

Black coffee has pH levels as low as 5. Lemon juice has a pH of 2. This means that the lemon juice is
times more acidic than the black coffee.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction:

VIEW

Solution:

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Figure 2.12 A pH scale. Here, red dots signify hydrogen ions (H+) and blue dots signify hydroxyl ions (OH). Also shown are the approximate pH values for some common solutions. This pH scale ranges from 0 (most acidic) to 14 (most basic). A change of one unit on the scale corresponds to a tenfold change in the amount of H+ ions. Photos, JupiterImages Corporation. Figure It Out: What is the approximate pH of cola?
The pH of black coffee is 5, and that of milk of magnesia is 10. Is the coffee twice as acidic as milk of magnesia?
If pond water has a pH of 5, the hydroxide concentration would be: a. 10-5M. b. 10-10M. c. 105M. d. 109M. e. 10-9M.
نقطة واحدة The pH value is calculated mathematically as the Log of the * .hydrogen ion (H+) concentration False True O
A solution has a pH of 5.4. What is its pOH? O 54 O 8.6 O -5.4 -8.6
Lemon juice has a pH around 2.5. Milk has a pH around 6.5-7. Which of the following statements about these two liquids is true? Lemon juice has a higher concentration of hydrogen ions compared to milk Milk has a lower concentration of hydroxyl ions compared to lemon juice Milk has a higher concentration of hydrogen ions compared to lemon juice The concentration of water in lemon juice and milk is identical
How much more acidic is stomach acid pH 2 than baking soda pH 9. Show your work.
From your data in Table 8.2 choose the correct pH for household chemical listed here. pH 6 purple pH 4 darker 1. Lemon juice pink 2. Mr. Clean pH 10- 12 3. Shampoo bluish green 4. Baking soda solution pH 10 teal or blue 5. Vinegar pH 2 lighter pink
A pH of 0 would mean an H+ concentration of 1M O True O False
An acid is a substance which raises hydrogen ion concentration O has a pH of 13 has equal number of H' and OH O raises hydroxyl ion concentration
The pH scale shows availability of reactive hydrogen ions (H+) in a liquid. The scale is logarithmic, so milk has 10 times as many H+ ions as pure water, for a given volume. How many more H+ ions does soda pop have compared to pure water? Write the number only.
At pH 10, [OH-] is— 10 M 5 M 10-10 M 10-4 M 0.0000001 M